Incidental Mutation 'R1184:Cenpe'
ID101887
Institutional Source Beutler Lab
Gene Symbol Cenpe
Ensembl Gene ENSMUSG00000045328
Gene Namecentromere protein E
Synonyms312kDa, CENP-E, Kif10, N-7 kinesin
MMRRC Submission 039256-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1184 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location135212537-135273611 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 135264422 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000057938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062893]
Predicted Effect probably null
Transcript: ENSMUST00000062893
SMART Domains Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328

DomainStartEndE-ValueType
KISc 4 337 2.4e-172 SMART
coiled coil region 493 612 N/A INTRINSIC
coiled coil region 637 752 N/A INTRINSIC
internal_repeat_1 768 801 3.5e-5 PROSPERO
coiled coil region 821 991 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
internal_repeat_2 1225 1238 6.26e-5 PROSPERO
low complexity region 1446 1467 N/A INTRINSIC
low complexity region 1480 1498 N/A INTRINSIC
internal_repeat_2 1614 1627 6.26e-5 PROSPERO
internal_repeat_1 2018 2051 3.5e-5 PROSPERO
coiled coil region 2226 2247 N/A INTRINSIC
coiled coil region 2316 2363 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200616
Meta Mutation Damage Score 0.484 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,160,912 R7G probably damaging Het
2410089E03Rik G T 15: 8,216,487 V1448L probably benign Het
Ahdc1 T A 4: 133,065,396 M1316K probably benign Het
Alkal1 A G 1: 6,389,488 Y96C probably damaging Het
Arhgap17 T C 7: 123,314,690 Y199C probably damaging Het
Bmp2 T C 2: 133,561,468 V313A probably damaging Het
Cacna1b C T 2: 24,687,745 probably null Het
Cars T C 7: 143,587,139 T141A probably damaging Het
Ccdc57 A G 11: 120,873,811 probably benign Het
Chadl T C 15: 81,693,057 S198G probably benign Het
Chd6 G C 2: 161,030,802 P286R probably damaging Het
Clec4a4 G T 6: 123,012,712 W104L probably benign Het
Coq4 G A 2: 29,788,334 probably benign Het
Crtc2 T A 3: 90,262,633 Y445* probably null Het
Dapk1 A T 13: 60,696,298 I44F probably damaging Het
Dcbld2 T A 16: 58,449,841 probably null Het
Dcun1d4 T C 5: 73,511,112 probably benign Het
Depdc7 A T 2: 104,730,178 probably benign Het
Dna2 A G 10: 62,959,198 D416G probably benign Het
Dnah2 A T 11: 69,499,190 I743N probably damaging Het
Dnah9 A G 11: 66,084,612 probably null Het
Dock3 A G 9: 106,969,800 S877P probably damaging Het
Eif3l T A 15: 79,075,766 probably null Het
Epha5 A T 5: 84,071,275 probably null Het
Ffar3 T A 7: 30,855,104 N264Y probably damaging Het
Fyb A T 15: 6,638,900 I525F probably damaging Het
Fyco1 A G 9: 123,819,153 F1239L probably damaging Het
Gcdh T C 8: 84,893,442 probably benign Het
Gk5 T C 9: 96,150,420 probably benign Het
Gm21188 A T 13: 120,035,131 N67K probably benign Het
Gm8979 A G 7: 106,083,952 V32A probably benign Het
Grm1 A G 10: 10,720,034 Y617H probably benign Het
Hhipl2 A T 1: 183,425,134 I131L probably damaging Het
Larp4b T C 13: 9,166,309 probably benign Het
Lrig2 T A 3: 104,490,911 I301F possibly damaging Het
Man2a2 A T 7: 80,362,965 I600N possibly damaging Het
Mylk2 G C 2: 152,913,741 probably null Het
Myo6 C T 9: 80,286,382 Q870* probably null Het
Napg T G 18: 62,994,338 H204Q probably benign Het
Neb G A 2: 52,263,947 T2384M probably damaging Het
Nek10 A G 14: 14,931,325 probably benign Het
Olfr1216 A G 2: 89,013,713 M117T probably damaging Het
Olfr1440 T C 19: 12,394,857 V198A probably benign Het
Olfr1462 T G 19: 13,191,375 L236R probably damaging Het
Olfr748 A C 14: 50,710,614 T95P probably benign Het
Pclo A G 5: 14,522,262 T554A unknown Het
Perm1 C A 4: 156,217,314 T105K probably damaging Het
Pik3r1 T C 13: 101,686,358 probably null Het
Pld5 A G 1: 176,044,896 I225T probably damaging Het
Plxnc1 T C 10: 94,831,333 probably benign Het
Ptpn12 A C 5: 20,998,356 S475A possibly damaging Het
Ptprt A G 2: 161,927,772 V391A possibly damaging Het
Rac2 T G 15: 78,565,945 D65A possibly damaging Het
Rgl3 A G 9: 21,977,380 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sebox A T 11: 78,503,849 T47S probably damaging Het
Sema4b A G 7: 80,224,640 T593A probably benign Het
Serpina3a C T 12: 104,116,528 Q187* probably null Het
Serpinb1a T C 13: 32,843,216 K248E probably benign Het
Serpinb9e A C 13: 33,259,774 E259A probably benign Het
Slc30a3 T A 5: 31,090,166 H44L probably damaging Het
Smarca2 T C 19: 26,770,933 probably benign Het
Snrnp200 T A 2: 127,236,817 C1801S probably damaging Het
Soat1 G A 1: 156,442,374 probably null Het
Spink6 T C 18: 44,071,538 probably benign Het
Spta1 G A 1: 174,184,690 R354H probably damaging Het
Tbck T A 3: 132,837,972 H861Q probably benign Het
Tgfbrap1 G A 1: 43,049,696 T849M possibly damaging Het
Tnrc6a A G 7: 123,170,340 N451S possibly damaging Het
Trim36 T C 18: 46,196,251 T41A probably damaging Het
Trmt112 C A 19: 6,910,353 probably benign Het
Trpc4ap A G 2: 155,645,070 probably benign Het
Ttll7 C T 3: 146,939,991 P535S probably damaging Het
Ttn A T 2: 76,861,432 probably benign Het
Txndc11 C T 16: 11,128,500 R149Q probably benign Het
Ubr4 C T 4: 139,437,198 probably benign Het
Usp30 G A 5: 114,103,827 probably null Het
Vmn1r195 A G 13: 22,279,011 Y217C probably damaging Het
Vps33b T A 7: 80,282,486 D135E probably benign Het
Vrk2 A G 11: 26,483,331 probably benign Het
Wdr81 G T 11: 75,452,983 P486Q probably damaging Het
Zfp788 T C 7: 41,648,326 Y129H probably damaging Het
Other mutations in Cenpe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Cenpe APN 3 135231455 critical splice donor site probably null
IGL00799:Cenpe APN 3 135228917 critical splice donor site probably null
IGL00815:Cenpe APN 3 135259351 missense probably benign
IGL01446:Cenpe APN 3 135237539 missense probably benign 0.01
IGL01469:Cenpe APN 3 135228806 missense probably damaging 1.00
IGL01843:Cenpe APN 3 135218507 missense possibly damaging 0.88
IGL02254:Cenpe APN 3 135255477 missense probably benign
IGL02337:Cenpe APN 3 135220276 splice site probably benign
IGL02382:Cenpe APN 3 135247386 missense probably benign
IGL02458:Cenpe APN 3 135230108 nonsense probably null
IGL02934:Cenpe APN 3 135264351 missense probably damaging 1.00
IGL03335:Cenpe APN 3 135243625 missense probably benign
R0086:Cenpe UTSW 3 135264424 splice site probably benign
R0173:Cenpe UTSW 3 135259983 missense probably benign 0.00
R0394:Cenpe UTSW 3 135216425 splice site probably benign
R0411:Cenpe UTSW 3 135222255 missense probably damaging 1.00
R0624:Cenpe UTSW 3 135246586 missense probably benign 0.00
R0634:Cenpe UTSW 3 135246827 missense probably damaging 1.00
R0648:Cenpe UTSW 3 135230082 missense probably damaging 1.00
R0691:Cenpe UTSW 3 135217305 missense probably damaging 1.00
R1530:Cenpe UTSW 3 135246902 missense possibly damaging 0.92
R1559:Cenpe UTSW 3 135270900 missense probably benign 0.07
R1562:Cenpe UTSW 3 135238394 missense possibly damaging 0.53
R1568:Cenpe UTSW 3 135239758 missense probably benign 0.01
R1712:Cenpe UTSW 3 135265933 missense probably damaging 0.99
R1828:Cenpe UTSW 3 135246496 missense probably damaging 0.99
R1846:Cenpe UTSW 3 135239845 missense probably damaging 1.00
R1861:Cenpe UTSW 3 135268979 missense probably damaging 1.00
R1938:Cenpe UTSW 3 135247479 missense probably damaging 0.98
R1961:Cenpe UTSW 3 135242493 missense probably damaging 1.00
R2062:Cenpe UTSW 3 135222321 splice site probably benign
R2118:Cenpe UTSW 3 135246884 missense possibly damaging 0.94
R2127:Cenpe UTSW 3 135239780 missense probably benign 0.08
R2156:Cenpe UTSW 3 135247474 missense probably benign 0.34
R2265:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2268:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2392:Cenpe UTSW 3 135248113 missense probably damaging 1.00
R2508:Cenpe UTSW 3 135241073 missense possibly damaging 0.92
R3084:Cenpe UTSW 3 135241021 missense probably damaging 1.00
R3779:Cenpe UTSW 3 135256576 missense possibly damaging 0.87
R3833:Cenpe UTSW 3 135222322 splice site probably benign
R3974:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135238472 critical splice donor site probably null
R4151:Cenpe UTSW 3 135215153 missense probably benign 0.36
R4166:Cenpe UTSW 3 135243718 missense probably damaging 1.00
R4581:Cenpe UTSW 3 135247000 missense probably benign 0.30
R4622:Cenpe UTSW 3 135243708 missense probably benign 0.22
R4692:Cenpe UTSW 3 135216379 missense probably benign 0.29
R4769:Cenpe UTSW 3 135248151 missense probably benign
R4976:Cenpe UTSW 3 135234876 missense probably damaging 1.00
R4983:Cenpe UTSW 3 135234928 missense probably damaging 1.00
R4990:Cenpe UTSW 3 135256640 missense probably damaging 1.00
R5002:Cenpe UTSW 3 135247081 missense probably benign
R5057:Cenpe UTSW 3 135220313 missense probably benign 0.14
R5063:Cenpe UTSW 3 135270954 missense probably damaging 0.99
R5181:Cenpe UTSW 3 135242303 missense probably damaging 0.99
R5281:Cenpe UTSW 3 135230150 missense possibly damaging 0.89
R5389:Cenpe UTSW 3 135259388 critical splice donor site probably null
R5517:Cenpe UTSW 3 135223265 missense probably damaging 1.00
R5521:Cenpe UTSW 3 135269065 missense probably damaging 1.00
R5607:Cenpe UTSW 3 135235076 nonsense probably null
R5608:Cenpe UTSW 3 135235076 nonsense probably null
R5627:Cenpe UTSW 3 135235473 missense possibly damaging 0.51
R5766:Cenpe UTSW 3 135248413 missense probably damaging 0.96
R5783:Cenpe UTSW 3 135261580 missense probably benign 0.00
R5933:Cenpe UTSW 3 135261628 missense probably benign 0.03
R6073:Cenpe UTSW 3 135260073 nonsense probably null
R6163:Cenpe UTSW 3 135269003 missense probably damaging 0.99
R6192:Cenpe UTSW 3 135248530 missense possibly damaging 0.93
R6224:Cenpe UTSW 3 135243775 missense possibly damaging 0.87
R6313:Cenpe UTSW 3 135230175 missense probably benign 0.26
R6326:Cenpe UTSW 3 135239778 missense probably benign 0.15
R6383:Cenpe UTSW 3 135251528 missense probably damaging 1.00
R6418:Cenpe UTSW 3 135251544 missense probably damaging 0.99
R6797:Cenpe UTSW 3 135238138 missense possibly damaging 0.92
R6810:Cenpe UTSW 3 135243822 missense probably benign 0.00
R6989:Cenpe UTSW 3 135235127 missense probably damaging 1.00
R7009:Cenpe UTSW 3 135235201 missense probably damaging 0.97
R7009:Cenpe UTSW 3 135235202 missense probably benign 0.02
R7039:Cenpe UTSW 3 135255456 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- AGTGTGGCGATCAAACAACTGGC -3'
(R):5'- AAGGCACCCTGCAAATGCTGAGAG -3'

Sequencing Primer
(F):5'- ACTGGCAAAATTAAAACTAATCACTG -3'
(R):5'- TGAGAGTCAGGCTCACATTC -3'
Posted On2014-01-15