Incidental Mutation 'R1184:Sema4b'
ID101915
Institutional Source Beutler Lab
Gene Symbol Sema4b
Ensembl Gene ENSMUSG00000030539
Gene Namesema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B
SynonymsSemac, SemC
MMRRC Submission 039256-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.755) question?
Stock #R1184 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location80186841-80226527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80224640 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 593 (T593A)
Ref Sequence ENSEMBL: ENSMUSP00000145622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032754] [ENSMUST00000065163] [ENSMUST00000071457] [ENSMUST00000123279] [ENSMUST00000205822] [ENSMUST00000205996] [ENSMUST00000206084] [ENSMUST00000206802]
Predicted Effect probably benign
Transcript: ENSMUST00000032754
AA Change: T593A

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000032754
Gene: ENSMUSG00000030539
AA Change: T593A

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Sema 57 494 8.07e-177 SMART
PSI 512 582 4.7e-9 SMART
low complexity region 626 639 N/A INTRINSIC
transmembrane domain 701 723 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065163
SMART Domains Protein: ENSMUSP00000070901
Gene: ENSMUSG00000030538

DomainStartEndE-ValueType
low complexity region 84 100 N/A INTRINSIC
EFh 107 135 4.4e0 SMART
EFh 152 180 1.17e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000071457
SMART Domains Protein: ENSMUSP00000071401
Gene: ENSMUSG00000030538

DomainStartEndE-ValueType
low complexity region 36 52 N/A INTRINSIC
EFh 59 87 4.4e0 SMART
EFh 104 132 1.17e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107383
SMART Domains Protein: ENSMUSP00000103006
Gene: ENSMUSG00000030539

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Sema 57 494 8.07e-177 SMART
PSI 512 550 2.68e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123279
SMART Domains Protein: ENSMUSP00000118926
Gene: ENSMUSG00000030538

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
EFh 33 61 4.4e0 SMART
EFh 78 106 1.17e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131402
Predicted Effect probably benign
Transcript: ENSMUST00000205822
AA Change: T593A

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000205996
Predicted Effect probably benign
Transcript: ENSMUST00000206084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206211
Predicted Effect probably benign
Transcript: ENSMUST00000206802
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 100% (83/83)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit normal cerebellar morphology. Mice homozygous for a knock-out allele exhibit enhanced memory response by way of increased IgE and IgG1 serum levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,160,912 R7G probably damaging Het
2410089E03Rik G T 15: 8,216,487 V1448L probably benign Het
Ahdc1 T A 4: 133,065,396 M1316K probably benign Het
Alkal1 A G 1: 6,389,488 Y96C probably damaging Het
Arhgap17 T C 7: 123,314,690 Y199C probably damaging Het
Bmp2 T C 2: 133,561,468 V313A probably damaging Het
Cacna1b C T 2: 24,687,745 probably null Het
Cars T C 7: 143,587,139 T141A probably damaging Het
Ccdc57 A G 11: 120,873,811 probably benign Het
Cenpe T C 3: 135,264,422 probably null Het
Chadl T C 15: 81,693,057 S198G probably benign Het
Chd6 G C 2: 161,030,802 P286R probably damaging Het
Clec4a4 G T 6: 123,012,712 W104L probably benign Het
Coq4 G A 2: 29,788,334 probably benign Het
Crtc2 T A 3: 90,262,633 Y445* probably null Het
Dapk1 A T 13: 60,696,298 I44F probably damaging Het
Dcbld2 T A 16: 58,449,841 probably null Het
Dcun1d4 T C 5: 73,511,112 probably benign Het
Depdc7 A T 2: 104,730,178 probably benign Het
Dna2 A G 10: 62,959,198 D416G probably benign Het
Dnah2 A T 11: 69,499,190 I743N probably damaging Het
Dnah9 A G 11: 66,084,612 probably null Het
Dock3 A G 9: 106,969,800 S877P probably damaging Het
Eif3l T A 15: 79,075,766 probably null Het
Epha5 A T 5: 84,071,275 probably null Het
Ffar3 T A 7: 30,855,104 N264Y probably damaging Het
Fyb A T 15: 6,638,900 I525F probably damaging Het
Fyco1 A G 9: 123,819,153 F1239L probably damaging Het
Gcdh T C 8: 84,893,442 probably benign Het
Gk5 T C 9: 96,150,420 probably benign Het
Gm21188 A T 13: 120,035,131 N67K probably benign Het
Gm8979 A G 7: 106,083,952 V32A probably benign Het
Grm1 A G 10: 10,720,034 Y617H probably benign Het
Hhipl2 A T 1: 183,425,134 I131L probably damaging Het
Larp4b T C 13: 9,166,309 probably benign Het
Lrig2 T A 3: 104,490,911 I301F possibly damaging Het
Man2a2 A T 7: 80,362,965 I600N possibly damaging Het
Mylk2 G C 2: 152,913,741 probably null Het
Myo6 C T 9: 80,286,382 Q870* probably null Het
Napg T G 18: 62,994,338 H204Q probably benign Het
Neb G A 2: 52,263,947 T2384M probably damaging Het
Nek10 A G 14: 14,931,325 probably benign Het
Olfr1216 A G 2: 89,013,713 M117T probably damaging Het
Olfr1440 T C 19: 12,394,857 V198A probably benign Het
Olfr1462 T G 19: 13,191,375 L236R probably damaging Het
Olfr748 A C 14: 50,710,614 T95P probably benign Het
Pclo A G 5: 14,522,262 T554A unknown Het
Perm1 C A 4: 156,217,314 T105K probably damaging Het
Pik3r1 T C 13: 101,686,358 probably null Het
Pld5 A G 1: 176,044,896 I225T probably damaging Het
Plxnc1 T C 10: 94,831,333 probably benign Het
Ptpn12 A C 5: 20,998,356 S475A possibly damaging Het
Ptprt A G 2: 161,927,772 V391A possibly damaging Het
Rac2 T G 15: 78,565,945 D65A possibly damaging Het
Rgl3 A G 9: 21,977,380 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sebox A T 11: 78,503,849 T47S probably damaging Het
Serpina3a C T 12: 104,116,528 Q187* probably null Het
Serpinb1a T C 13: 32,843,216 K248E probably benign Het
Serpinb9e A C 13: 33,259,774 E259A probably benign Het
Slc30a3 T A 5: 31,090,166 H44L probably damaging Het
Smarca2 T C 19: 26,770,933 probably benign Het
Snrnp200 T A 2: 127,236,817 C1801S probably damaging Het
Soat1 G A 1: 156,442,374 probably null Het
Spink6 T C 18: 44,071,538 probably benign Het
Spta1 G A 1: 174,184,690 R354H probably damaging Het
Tbck T A 3: 132,837,972 H861Q probably benign Het
Tgfbrap1 G A 1: 43,049,696 T849M possibly damaging Het
Tnrc6a A G 7: 123,170,340 N451S possibly damaging Het
Trim36 T C 18: 46,196,251 T41A probably damaging Het
Trmt112 C A 19: 6,910,353 probably benign Het
Trpc4ap A G 2: 155,645,070 probably benign Het
Ttll7 C T 3: 146,939,991 P535S probably damaging Het
Ttn A T 2: 76,861,432 probably benign Het
Txndc11 C T 16: 11,128,500 R149Q probably benign Het
Ubr4 C T 4: 139,437,198 probably benign Het
Usp30 G A 5: 114,103,827 probably null Het
Vmn1r195 A G 13: 22,279,011 Y217C probably damaging Het
Vps33b T A 7: 80,282,486 D135E probably benign Het
Vrk2 A G 11: 26,483,331 probably benign Het
Wdr81 G T 11: 75,452,983 P486Q probably damaging Het
Zfp788 T C 7: 41,648,326 Y129H probably damaging Het
Other mutations in Sema4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Sema4b APN 7 80215696 missense probably damaging 1.00
IGL02584:Sema4b APN 7 80224988 missense probably benign
IGL02657:Sema4b APN 7 80217041 missense probably damaging 1.00
R0114:Sema4b UTSW 7 80219078 splice site probably benign
R0480:Sema4b UTSW 7 80220206 missense probably damaging 1.00
R1545:Sema4b UTSW 7 80219023 missense probably benign 0.02
R1687:Sema4b UTSW 7 80219262 missense probably damaging 1.00
R1880:Sema4b UTSW 7 80216792 missense probably damaging 0.96
R1881:Sema4b UTSW 7 80216792 missense probably damaging 0.96
R2180:Sema4b UTSW 7 80212835 missense probably benign 0.28
R2352:Sema4b UTSW 7 80220879 missense probably damaging 0.99
R2424:Sema4b UTSW 7 80219275 missense probably damaging 1.00
R3913:Sema4b UTSW 7 80220474 missense probably benign
R4353:Sema4b UTSW 7 80215651 missense probably damaging 1.00
R4757:Sema4b UTSW 7 80216829 missense probably damaging 1.00
R4921:Sema4b UTSW 7 80198756 missense possibly damaging 0.77
R5004:Sema4b UTSW 7 80216345 missense probably benign 0.13
R5399:Sema4b UTSW 7 80224886 missense probably benign
R5599:Sema4b UTSW 7 80213291 missense probably benign 0.40
R5820:Sema4b UTSW 7 80224958 missense probably damaging 0.99
R5840:Sema4b UTSW 7 80218949 missense probably damaging 1.00
R5901:Sema4b UTSW 7 80224967 missense possibly damaging 0.49
R6600:Sema4b UTSW 7 80212928 missense probably benign 0.42
R6749:Sema4b UTSW 7 80220201 missense possibly damaging 0.56
R6992:Sema4b UTSW 7 80220152 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GAGTCACTTAGTCCCAACCATCGC -3'
(R):5'- CCACAAGCTGCTGGAATCCTTCTTC -3'

Sequencing Primer
(F):5'- tcagtggacagcagggag -3'
(R):5'- TTCTTCTATCGACCAACACTGGAAC -3'
Posted On2014-01-15