Incidental Mutation 'R1184:Rgl3'
ID101930
Institutional Source Beutler Lab
Gene Symbol Rgl3
Ensembl Gene ENSMUSG00000040146
Gene Nameral guanine nucleotide dissociation stimulator-like 3
Synonyms1300003D20Rik
MMRRC Submission 039256-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R1184 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21968711-21989446 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 21977380 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045726] [ENSMUST00000214026] [ENSMUST00000215851]
Predicted Effect probably null
Transcript: ENSMUST00000045726
SMART Domains Protein: ENSMUSP00000035726
Gene: ENSMUSG00000040146

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
RasGEFN 63 201 1.35e-6 SMART
RasGEF 244 504 2.74e-84 SMART
low complexity region 533 579 N/A INTRINSIC
RA 609 699 3.36e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213130
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213558
Predicted Effect probably benign
Transcript: ENSMUST00000214026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214713
Predicted Effect probably benign
Transcript: ENSMUST00000215851
Meta Mutation Damage Score 0.448 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 100% (83/83)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,160,912 R7G probably damaging Het
2410089E03Rik G T 15: 8,216,487 V1448L probably benign Het
Ahdc1 T A 4: 133,065,396 M1316K probably benign Het
Alkal1 A G 1: 6,389,488 Y96C probably damaging Het
Arhgap17 T C 7: 123,314,690 Y199C probably damaging Het
Bmp2 T C 2: 133,561,468 V313A probably damaging Het
Cacna1b C T 2: 24,687,745 probably null Het
Cars T C 7: 143,587,139 T141A probably damaging Het
Ccdc57 A G 11: 120,873,811 probably benign Het
Cenpe T C 3: 135,264,422 probably null Het
Chadl T C 15: 81,693,057 S198G probably benign Het
Chd6 G C 2: 161,030,802 P286R probably damaging Het
Clec4a4 G T 6: 123,012,712 W104L probably benign Het
Coq4 G A 2: 29,788,334 probably benign Het
Crtc2 T A 3: 90,262,633 Y445* probably null Het
Dapk1 A T 13: 60,696,298 I44F probably damaging Het
Dcbld2 T A 16: 58,449,841 probably null Het
Dcun1d4 T C 5: 73,511,112 probably benign Het
Depdc7 A T 2: 104,730,178 probably benign Het
Dna2 A G 10: 62,959,198 D416G probably benign Het
Dnah2 A T 11: 69,499,190 I743N probably damaging Het
Dnah9 A G 11: 66,084,612 probably null Het
Dock3 A G 9: 106,969,800 S877P probably damaging Het
Eif3l T A 15: 79,075,766 probably null Het
Epha5 A T 5: 84,071,275 probably null Het
Ffar3 T A 7: 30,855,104 N264Y probably damaging Het
Fyb A T 15: 6,638,900 I525F probably damaging Het
Fyco1 A G 9: 123,819,153 F1239L probably damaging Het
Gcdh T C 8: 84,893,442 probably benign Het
Gk5 T C 9: 96,150,420 probably benign Het
Gm21188 A T 13: 120,035,131 N67K probably benign Het
Gm8979 A G 7: 106,083,952 V32A probably benign Het
Grm1 A G 10: 10,720,034 Y617H probably benign Het
Hhipl2 A T 1: 183,425,134 I131L probably damaging Het
Larp4b T C 13: 9,166,309 probably benign Het
Lrig2 T A 3: 104,490,911 I301F possibly damaging Het
Man2a2 A T 7: 80,362,965 I600N possibly damaging Het
Mylk2 G C 2: 152,913,741 probably null Het
Myo6 C T 9: 80,286,382 Q870* probably null Het
Napg T G 18: 62,994,338 H204Q probably benign Het
Neb G A 2: 52,263,947 T2384M probably damaging Het
Nek10 A G 14: 14,931,325 probably benign Het
Olfr1216 A G 2: 89,013,713 M117T probably damaging Het
Olfr1440 T C 19: 12,394,857 V198A probably benign Het
Olfr1462 T G 19: 13,191,375 L236R probably damaging Het
Olfr748 A C 14: 50,710,614 T95P probably benign Het
Pclo A G 5: 14,522,262 T554A unknown Het
Perm1 C A 4: 156,217,314 T105K probably damaging Het
Pik3r1 T C 13: 101,686,358 probably null Het
Pld5 A G 1: 176,044,896 I225T probably damaging Het
Plxnc1 T C 10: 94,831,333 probably benign Het
Ptpn12 A C 5: 20,998,356 S475A possibly damaging Het
Ptprt A G 2: 161,927,772 V391A possibly damaging Het
Rac2 T G 15: 78,565,945 D65A possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sebox A T 11: 78,503,849 T47S probably damaging Het
Sema4b A G 7: 80,224,640 T593A probably benign Het
Serpina3a C T 12: 104,116,528 Q187* probably null Het
Serpinb1a T C 13: 32,843,216 K248E probably benign Het
Serpinb9e A C 13: 33,259,774 E259A probably benign Het
Slc30a3 T A 5: 31,090,166 H44L probably damaging Het
Smarca2 T C 19: 26,770,933 probably benign Het
Snrnp200 T A 2: 127,236,817 C1801S probably damaging Het
Soat1 G A 1: 156,442,374 probably null Het
Spink6 T C 18: 44,071,538 probably benign Het
Spta1 G A 1: 174,184,690 R354H probably damaging Het
Tbck T A 3: 132,837,972 H861Q probably benign Het
Tgfbrap1 G A 1: 43,049,696 T849M possibly damaging Het
Tnrc6a A G 7: 123,170,340 N451S possibly damaging Het
Trim36 T C 18: 46,196,251 T41A probably damaging Het
Trmt112 C A 19: 6,910,353 probably benign Het
Trpc4ap A G 2: 155,645,070 probably benign Het
Ttll7 C T 3: 146,939,991 P535S probably damaging Het
Ttn A T 2: 76,861,432 probably benign Het
Txndc11 C T 16: 11,128,500 R149Q probably benign Het
Ubr4 C T 4: 139,437,198 probably benign Het
Usp30 G A 5: 114,103,827 probably null Het
Vmn1r195 A G 13: 22,279,011 Y217C probably damaging Het
Vps33b T A 7: 80,282,486 D135E probably benign Het
Vrk2 A G 11: 26,483,331 probably benign Het
Wdr81 G T 11: 75,452,983 P486Q probably damaging Het
Zfp788 T C 7: 41,648,326 Y129H probably damaging Het
Other mutations in Rgl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Rgl3 APN 9 21977239 missense probably damaging 1.00
IGL00770:Rgl3 APN 9 21987722 splice site probably benign
IGL00774:Rgl3 APN 9 21987722 splice site probably benign
IGL02071:Rgl3 APN 9 21988263 missense probably benign 0.00
IGL02172:Rgl3 APN 9 21976838 missense probably damaging 1.00
IGL02190:Rgl3 APN 9 21981708 missense probably benign 0.00
IGL02277:Rgl3 APN 9 21974109 missense probably damaging 1.00
IGL02515:Rgl3 APN 9 21974100 missense possibly damaging 0.93
R0077:Rgl3 UTSW 9 21974102 missense probably benign 0.00
R0126:Rgl3 UTSW 9 21975812 missense probably benign 0.06
R0360:Rgl3 UTSW 9 21976857 missense probably damaging 0.97
R0421:Rgl3 UTSW 9 21976032 missense probably benign 0.06
R0556:Rgl3 UTSW 9 21975844 nonsense probably null
R0751:Rgl3 UTSW 9 21977380 critical splice donor site probably null
R1548:Rgl3 UTSW 9 21980706 missense probably benign 0.11
R2176:Rgl3 UTSW 9 21975958 utr 3 prime probably benign
R3154:Rgl3 UTSW 9 21980774 missense probably damaging 1.00
R3607:Rgl3 UTSW 9 21987691 missense probably damaging 0.98
R3803:Rgl3 UTSW 9 21976025 missense probably damaging 1.00
R3958:Rgl3 UTSW 9 21975589 intron probably benign
R4081:Rgl3 UTSW 9 21987675 missense possibly damaging 0.79
R4937:Rgl3 UTSW 9 21987708 nonsense probably null
R5068:Rgl3 UTSW 9 21988044 critical splice donor site probably null
R5070:Rgl3 UTSW 9 21988044 critical splice donor site probably null
R5217:Rgl3 UTSW 9 21987648 makesense probably null
R5772:Rgl3 UTSW 9 21981612 missense probably benign 0.00
R5819:Rgl3 UTSW 9 21981602 critical splice donor site probably null
R6509:Rgl3 UTSW 9 21971908 missense probably benign 0.00
X0019:Rgl3 UTSW 9 21981479 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCGGTAAGGCTGTATCCAGCATAAC -3'
(R):5'- TTATGCACTGCATGGGATGGGAC -3'

Sequencing Primer
(F):5'- GTATCCAGCATAACCAAGTCTGTG -3'
(R):5'- gctcataccacaatctgcttc -3'
Posted On2014-01-15