Incidental Mutation 'R1184:Dock3'
ID101936
Institutional Source Beutler Lab
Gene Symbol Dock3
Ensembl Gene ENSMUSG00000039716
Gene Namededicator of cyto-kinesis 3
SynonymsPBP, Moca
MMRRC Submission 039256-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.483) question?
Stock #R1184 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location106892825-107231909 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106969800 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 877 (S877P)
Ref Sequence ENSEMBL: ENSMUSP00000047652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044532]
Predicted Effect probably damaging
Transcript: ENSMUST00000044532
AA Change: S877P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047652
Gene: ENSMUSG00000039716
AA Change: S877P

DomainStartEndE-ValueType
SH3 9 66 3.85e-9 SMART
Pfam:DOCK_N 69 412 1.4e-120 PFAM
Pfam:DOCK-C2 417 608 7.7e-56 PFAM
low complexity region 854 867 N/A INTRINSIC
low complexity region 892 916 N/A INTRINSIC
Pfam:DHR-2 1121 1628 9e-133 PFAM
low complexity region 1679 1690 N/A INTRINSIC
low complexity region 1693 1704 N/A INTRINSIC
low complexity region 1730 1754 N/A INTRINSIC
low complexity region 1880 1902 N/A INTRINSIC
low complexity region 1963 1977 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165075
SMART Domains Protein: ENSMUSP00000130873
Gene: ENSMUSG00000039716

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is specifically expressed in the central nervous system (CNS). It encodes a member of the DOCK (dedicator of cytokinesis) family of guanine nucleotide exchange factors (GEFs). This protein, dedicator of cytokinesis 3 (DOCK3), is also known as modifier of cell adhesion (MOCA) and presenilin-binding protein (PBP). The DOCK3 and DOCK1, -2 and -4 share several conserved amino acids in their DHR-2 (DOCK homology region 2) domains that are required for GEF activity, and bind directly to WAVE proteins [Wiskott-Aldrich syndrome protein (WASP) family Verprolin-homologous proteins] via their DHR-1 domains. The DOCK3 induces axonal outgrowth in CNS by stimulating membrane recruitment of the WAVE complex and activating the small G protein Rac1. This gene is associated with an attention deficit hyperactivity disorder-like phenotype by a complex chromosomal rearrangement. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal behaviors and muscular weakness associated with axonal dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,160,912 R7G probably damaging Het
2410089E03Rik G T 15: 8,216,487 V1448L probably benign Het
Ahdc1 T A 4: 133,065,396 M1316K probably benign Het
Alkal1 A G 1: 6,389,488 Y96C probably damaging Het
Arhgap17 T C 7: 123,314,690 Y199C probably damaging Het
Bmp2 T C 2: 133,561,468 V313A probably damaging Het
Cacna1b C T 2: 24,687,745 probably null Het
Cars T C 7: 143,587,139 T141A probably damaging Het
Ccdc57 A G 11: 120,873,811 probably benign Het
Cenpe T C 3: 135,264,422 probably null Het
Chadl T C 15: 81,693,057 S198G probably benign Het
Chd6 G C 2: 161,030,802 P286R probably damaging Het
Clec4a4 G T 6: 123,012,712 W104L probably benign Het
Coq4 G A 2: 29,788,334 probably benign Het
Crtc2 T A 3: 90,262,633 Y445* probably null Het
Dapk1 A T 13: 60,696,298 I44F probably damaging Het
Dcbld2 T A 16: 58,449,841 probably null Het
Dcun1d4 T C 5: 73,511,112 probably benign Het
Depdc7 A T 2: 104,730,178 probably benign Het
Dna2 A G 10: 62,959,198 D416G probably benign Het
Dnah2 A T 11: 69,499,190 I743N probably damaging Het
Dnah9 A G 11: 66,084,612 probably null Het
Eif3l T A 15: 79,075,766 probably null Het
Epha5 A T 5: 84,071,275 probably null Het
Ffar3 T A 7: 30,855,104 N264Y probably damaging Het
Fyb A T 15: 6,638,900 I525F probably damaging Het
Fyco1 A G 9: 123,819,153 F1239L probably damaging Het
Gcdh T C 8: 84,893,442 probably benign Het
Gk5 T C 9: 96,150,420 probably benign Het
Gm21188 A T 13: 120,035,131 N67K probably benign Het
Gm8979 A G 7: 106,083,952 V32A probably benign Het
Grm1 A G 10: 10,720,034 Y617H probably benign Het
Hhipl2 A T 1: 183,425,134 I131L probably damaging Het
Larp4b T C 13: 9,166,309 probably benign Het
Lrig2 T A 3: 104,490,911 I301F possibly damaging Het
Man2a2 A T 7: 80,362,965 I600N possibly damaging Het
Mylk2 G C 2: 152,913,741 probably null Het
Myo6 C T 9: 80,286,382 Q870* probably null Het
Napg T G 18: 62,994,338 H204Q probably benign Het
Neb G A 2: 52,263,947 T2384M probably damaging Het
Nek10 A G 14: 14,931,325 probably benign Het
Olfr1216 A G 2: 89,013,713 M117T probably damaging Het
Olfr1440 T C 19: 12,394,857 V198A probably benign Het
Olfr1462 T G 19: 13,191,375 L236R probably damaging Het
Olfr748 A C 14: 50,710,614 T95P probably benign Het
Pclo A G 5: 14,522,262 T554A unknown Het
Perm1 C A 4: 156,217,314 T105K probably damaging Het
Pik3r1 T C 13: 101,686,358 probably null Het
Pld5 A G 1: 176,044,896 I225T probably damaging Het
Plxnc1 T C 10: 94,831,333 probably benign Het
Ptpn12 A C 5: 20,998,356 S475A possibly damaging Het
Ptprt A G 2: 161,927,772 V391A possibly damaging Het
Rac2 T G 15: 78,565,945 D65A possibly damaging Het
Rgl3 A G 9: 21,977,380 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sebox A T 11: 78,503,849 T47S probably damaging Het
Sema4b A G 7: 80,224,640 T593A probably benign Het
Serpina3a C T 12: 104,116,528 Q187* probably null Het
Serpinb1a T C 13: 32,843,216 K248E probably benign Het
Serpinb9e A C 13: 33,259,774 E259A probably benign Het
Slc30a3 T A 5: 31,090,166 H44L probably damaging Het
Smarca2 T C 19: 26,770,933 probably benign Het
Snrnp200 T A 2: 127,236,817 C1801S probably damaging Het
Soat1 G A 1: 156,442,374 probably null Het
Spink6 T C 18: 44,071,538 probably benign Het
Spta1 G A 1: 174,184,690 R354H probably damaging Het
Tbck T A 3: 132,837,972 H861Q probably benign Het
Tgfbrap1 G A 1: 43,049,696 T849M possibly damaging Het
Tnrc6a A G 7: 123,170,340 N451S possibly damaging Het
Trim36 T C 18: 46,196,251 T41A probably damaging Het
Trmt112 C A 19: 6,910,353 probably benign Het
Trpc4ap A G 2: 155,645,070 probably benign Het
Ttll7 C T 3: 146,939,991 P535S probably damaging Het
Ttn A T 2: 76,861,432 probably benign Het
Txndc11 C T 16: 11,128,500 R149Q probably benign Het
Ubr4 C T 4: 139,437,198 probably benign Het
Usp30 G A 5: 114,103,827 probably null Het
Vmn1r195 A G 13: 22,279,011 Y217C probably damaging Het
Vps33b T A 7: 80,282,486 D135E probably benign Het
Vrk2 A G 11: 26,483,331 probably benign Het
Wdr81 G T 11: 75,452,983 P486Q probably damaging Het
Zfp788 T C 7: 41,648,326 Y129H probably damaging Het
Other mutations in Dock3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Dock3 APN 9 106911377 splice site probably benign
IGL01067:Dock3 APN 9 107082373 critical splice donor site probably null
IGL01160:Dock3 APN 9 106906688 missense probably damaging 1.00
IGL01290:Dock3 APN 9 106958400 splice site probably benign
IGL01291:Dock3 APN 9 106958400 splice site probably benign
IGL01391:Dock3 APN 9 106907234 missense possibly damaging 0.55
IGL01399:Dock3 APN 9 106993471 missense probably benign 0.06
IGL01660:Dock3 APN 9 107032364 splice site probably benign
IGL01752:Dock3 APN 9 107025313 splice site probably benign
IGL01820:Dock3 APN 9 106895893 missense probably damaging 1.00
IGL01908:Dock3 APN 9 106906662 missense possibly damaging 0.81
IGL02191:Dock3 APN 9 106938141 missense probably benign
IGL02227:Dock3 APN 9 107062055 missense probably damaging 0.98
IGL02309:Dock3 APN 9 106913152 missense probably damaging 1.00
IGL02408:Dock3 APN 9 106913099 splice site probably benign
IGL02469:Dock3 APN 9 106986016 missense probably damaging 0.98
IGL02545:Dock3 APN 9 107062072 missense probably damaging 1.00
IGL02894:Dock3 APN 9 106930099 missense probably benign 0.00
IGL02934:Dock3 APN 9 107023745 missense probably benign 0.01
IGL03027:Dock3 APN 9 106993478 missense probably damaging 0.98
IGL03068:Dock3 APN 9 106964759 missense possibly damaging 0.82
IGL03128:Dock3 APN 9 107032292 missense probably benign 0.05
IGL03161:Dock3 APN 9 107023788 missense probably damaging 0.99
IGL03263:Dock3 APN 9 106930131 splice site probably benign
IGL03279:Dock3 APN 9 106911248 splice site probably benign
IGL03366:Dock3 APN 9 107005433 missense probably benign 0.01
Implosion UTSW 9 106937926 missense probably benign 0.00
Tight UTSW 9 106994881 missense probably damaging 1.00
ANU05:Dock3 UTSW 9 106895663 missense probably benign
R0025:Dock3 UTSW 9 106913268 missense possibly damaging 0.90
R0025:Dock3 UTSW 9 106913268 missense possibly damaging 0.90
R0030:Dock3 UTSW 9 106912313 missense possibly damaging 0.64
R0076:Dock3 UTSW 9 106911486 splice site probably benign
R0076:Dock3 UTSW 9 106911486 splice site probably benign
R0206:Dock3 UTSW 9 106996996 nonsense probably null
R0208:Dock3 UTSW 9 106996996 nonsense probably null
R0384:Dock3 UTSW 9 106901895 splice site probably benign
R0610:Dock3 UTSW 9 107023788 missense probably damaging 0.99
R0731:Dock3 UTSW 9 106969856 missense probably damaging 1.00
R1350:Dock3 UTSW 9 106914632 missense possibly damaging 0.52
R1393:Dock3 UTSW 9 106911349 missense probably damaging 1.00
R1424:Dock3 UTSW 9 106913193 missense probably damaging 1.00
R1469:Dock3 UTSW 9 106955709 missense probably benign 0.37
R1469:Dock3 UTSW 9 106955709 missense probably benign 0.37
R1539:Dock3 UTSW 9 106952364 missense probably damaging 1.00
R1539:Dock3 UTSW 9 106996913 missense probably benign 0.23
R1571:Dock3 UTSW 9 106937959 missense possibly damaging 0.92
R1682:Dock3 UTSW 9 106973841 missense probably damaging 0.98
R1795:Dock3 UTSW 9 107025335 missense probably damaging 0.99
R1987:Dock3 UTSW 9 107108421 missense probably benign 0.01
R2000:Dock3 UTSW 9 106992961 splice site probably benign
R2074:Dock3 UTSW 9 106993463 missense possibly damaging 0.46
R2114:Dock3 UTSW 9 106993544 missense probably benign 0.00
R2265:Dock3 UTSW 9 106941326 missense probably damaging 1.00
R2269:Dock3 UTSW 9 106941326 missense probably damaging 1.00
R2370:Dock3 UTSW 9 106952355 missense probably damaging 1.00
R2377:Dock3 UTSW 9 106895891 missense probably damaging 0.98
R2385:Dock3 UTSW 9 106991125 missense probably damaging 1.00
R2426:Dock3 UTSW 9 106914541 missense possibly damaging 0.76
R3076:Dock3 UTSW 9 106941526 critical splice acceptor site probably null
R3122:Dock3 UTSW 9 106911343 missense probably damaging 0.99
R4052:Dock3 UTSW 9 106973796 missense probably damaging 0.99
R4294:Dock3 UTSW 9 106930043 missense probably damaging 1.00
R4623:Dock3 UTSW 9 107062045 missense possibly damaging 0.61
R4664:Dock3 UTSW 9 106993544 missense possibly damaging 0.71
R4705:Dock3 UTSW 9 107025336 missense probably damaging 1.00
R4771:Dock3 UTSW 9 106952358 missense possibly damaging 0.89
R4898:Dock3 UTSW 9 106930067 missense probably damaging 1.00
R4898:Dock3 UTSW 9 106992972 missense possibly damaging 0.75
R4948:Dock3 UTSW 9 106991155 missense probably damaging 0.96
R4961:Dock3 UTSW 9 106941316 missense probably damaging 1.00
R4986:Dock3 UTSW 9 106931983 missense probably damaging 1.00
R5054:Dock3 UTSW 9 106937906 missense probably damaging 1.00
R5065:Dock3 UTSW 9 106955684 missense probably damaging 1.00
R5081:Dock3 UTSW 9 106991093 missense probably damaging 1.00
R5101:Dock3 UTSW 9 106969781 missense probably damaging 1.00
R5135:Dock3 UTSW 9 106932997 missense probably damaging 1.00
R5227:Dock3 UTSW 9 106986070 missense probably damaging 1.00
R5257:Dock3 UTSW 9 106996925 missense probably damaging 1.00
R5258:Dock3 UTSW 9 106996925 missense probably damaging 1.00
R5273:Dock3 UTSW 9 106900705 critical splice donor site probably null
R5322:Dock3 UTSW 9 106901829 missense probably benign 0.14
R5482:Dock3 UTSW 9 106978738 nonsense probably null
R5553:Dock3 UTSW 9 106991110 missense possibly damaging 0.81
R5631:Dock3 UTSW 9 106955699 missense probably benign 0.01
R5739:Dock3 UTSW 9 106973796 missense possibly damaging 0.92
R5838:Dock3 UTSW 9 106895488 missense possibly damaging 0.51
R5888:Dock3 UTSW 9 107023803 missense probably benign 0.12
R5960:Dock3 UTSW 9 106911355 nonsense probably null
R5974:Dock3 UTSW 9 106994062 missense probably damaging 1.00
R6116:Dock3 UTSW 9 106931962 missense probably damaging 1.00
R6162:Dock3 UTSW 9 106964799 missense possibly damaging 0.88
R6176:Dock3 UTSW 9 106912948 missense probably benign 0.05
R6219:Dock3 UTSW 9 106994881 missense probably damaging 1.00
R6238:Dock3 UTSW 9 106912948 missense probably benign 0.05
R6266:Dock3 UTSW 9 106964753 missense probably damaging 0.99
R6291:Dock3 UTSW 9 106908432 missense probably benign
R6531:Dock3 UTSW 9 106967216 missense probably benign
R6567:Dock3 UTSW 9 106896747 missense probably benign 0.13
R6572:Dock3 UTSW 9 106989475 missense probably damaging 0.99
R6620:Dock3 UTSW 9 106937926 missense probably benign 0.00
R6726:Dock3 UTSW 9 107159452 nonsense probably null
R7085:Dock3 UTSW 9 106901887 missense not run
R7151:Dock3 UTSW 9 106964717 missense not run
X0023:Dock3 UTSW 9 106985998 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTTGTCTCACAAGACGTAGGATGCC -3'
(R):5'- ATCTCCTTCAAGTCCCACAATGCTG -3'

Sequencing Primer
(F):5'- CTGTACTGAGAAACTTGCTAGGC -3'
(R):5'- GCTGCTATCTTCTATCAGTAGCTAGG -3'
Posted On2014-01-15