Incidental Mutation 'R1184:Fyco1'
ID101938
Institutional Source Beutler Lab
Gene Symbol Fyco1
Ensembl Gene ENSMUSG00000025241
Gene NameFYVE and coiled-coil domain containing 1
SynonymsMem2, ZFYVE7, 2810409M01Rik
MMRRC Submission 039256-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1184 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location123789500-123851899 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123819153 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1239 (F1239L)
Ref Sequence ENSEMBL: ENSMUSP00000133222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084715] [ENSMUST00000167595]
Predicted Effect probably damaging
Transcript: ENSMUST00000084715
AA Change: F1239L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081764
Gene: ENSMUSG00000025241
AA Change: F1239L

DomainStartEndE-ValueType
Pfam:RUN 19 167 4.7e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
coiled coil region 348 1110 N/A INTRINSIC
FYVE 1124 1191 2.69e-16 SMART
PDB:1OLM|E 1343 1428 1e-5 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000167595
AA Change: F1239L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133222
Gene: ENSMUSG00000025241
AA Change: F1239L

DomainStartEndE-ValueType
Pfam:RUN 20 167 7.8e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
coiled coil region 348 1110 N/A INTRINSIC
FYVE 1124 1191 2.69e-16 SMART
PDB:1OLM|E 1343 1428 1e-5 PDB
Meta Mutation Damage Score 0.248 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a RUN domain, FYVE-type zinc finger domain and Golgi dynamics (GOLD) domain. The encoded protein plays a role in microtubule plus end-directed transport of autophagic vesicles through interactions with the small GTPase Rab7, phosphatidylinositol-3-phosphate (PI3P) and the autophagosome marker LC3. Mutations in this gene are a cause of autosomal recessive congenital cataract-2 (CATC2). [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,160,912 R7G probably damaging Het
2410089E03Rik G T 15: 8,216,487 V1448L probably benign Het
Ahdc1 T A 4: 133,065,396 M1316K probably benign Het
Alkal1 A G 1: 6,389,488 Y96C probably damaging Het
Arhgap17 T C 7: 123,314,690 Y199C probably damaging Het
Bmp2 T C 2: 133,561,468 V313A probably damaging Het
Cacna1b C T 2: 24,687,745 probably null Het
Cars T C 7: 143,587,139 T141A probably damaging Het
Ccdc57 A G 11: 120,873,811 probably benign Het
Cenpe T C 3: 135,264,422 probably null Het
Chadl T C 15: 81,693,057 S198G probably benign Het
Chd6 G C 2: 161,030,802 P286R probably damaging Het
Clec4a4 G T 6: 123,012,712 W104L probably benign Het
Coq4 G A 2: 29,788,334 probably benign Het
Crtc2 T A 3: 90,262,633 Y445* probably null Het
Dapk1 A T 13: 60,696,298 I44F probably damaging Het
Dcbld2 T A 16: 58,449,841 probably null Het
Dcun1d4 T C 5: 73,511,112 probably benign Het
Depdc7 A T 2: 104,730,178 probably benign Het
Dna2 A G 10: 62,959,198 D416G probably benign Het
Dnah2 A T 11: 69,499,190 I743N probably damaging Het
Dnah9 A G 11: 66,084,612 probably null Het
Dock3 A G 9: 106,969,800 S877P probably damaging Het
Eif3l T A 15: 79,075,766 probably null Het
Epha5 A T 5: 84,071,275 probably null Het
Ffar3 T A 7: 30,855,104 N264Y probably damaging Het
Fyb A T 15: 6,638,900 I525F probably damaging Het
Gcdh T C 8: 84,893,442 probably benign Het
Gk5 T C 9: 96,150,420 probably benign Het
Gm21188 A T 13: 120,035,131 N67K probably benign Het
Gm8979 A G 7: 106,083,952 V32A probably benign Het
Grm1 A G 10: 10,720,034 Y617H probably benign Het
Hhipl2 A T 1: 183,425,134 I131L probably damaging Het
Larp4b T C 13: 9,166,309 probably benign Het
Lrig2 T A 3: 104,490,911 I301F possibly damaging Het
Man2a2 A T 7: 80,362,965 I600N possibly damaging Het
Mylk2 G C 2: 152,913,741 probably null Het
Myo6 C T 9: 80,286,382 Q870* probably null Het
Napg T G 18: 62,994,338 H204Q probably benign Het
Neb G A 2: 52,263,947 T2384M probably damaging Het
Nek10 A G 14: 14,931,325 probably benign Het
Olfr1216 A G 2: 89,013,713 M117T probably damaging Het
Olfr1440 T C 19: 12,394,857 V198A probably benign Het
Olfr1462 T G 19: 13,191,375 L236R probably damaging Het
Olfr748 A C 14: 50,710,614 T95P probably benign Het
Pclo A G 5: 14,522,262 T554A unknown Het
Perm1 C A 4: 156,217,314 T105K probably damaging Het
Pik3r1 T C 13: 101,686,358 probably null Het
Pld5 A G 1: 176,044,896 I225T probably damaging Het
Plxnc1 T C 10: 94,831,333 probably benign Het
Ptpn12 A C 5: 20,998,356 S475A possibly damaging Het
Ptprt A G 2: 161,927,772 V391A possibly damaging Het
Rac2 T G 15: 78,565,945 D65A possibly damaging Het
Rgl3 A G 9: 21,977,380 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sebox A T 11: 78,503,849 T47S probably damaging Het
Sema4b A G 7: 80,224,640 T593A probably benign Het
Serpina3a C T 12: 104,116,528 Q187* probably null Het
Serpinb1a T C 13: 32,843,216 K248E probably benign Het
Serpinb9e A C 13: 33,259,774 E259A probably benign Het
Slc30a3 T A 5: 31,090,166 H44L probably damaging Het
Smarca2 T C 19: 26,770,933 probably benign Het
Snrnp200 T A 2: 127,236,817 C1801S probably damaging Het
Soat1 G A 1: 156,442,374 probably null Het
Spink6 T C 18: 44,071,538 probably benign Het
Spta1 G A 1: 174,184,690 R354H probably damaging Het
Tbck T A 3: 132,837,972 H861Q probably benign Het
Tgfbrap1 G A 1: 43,049,696 T849M possibly damaging Het
Tnrc6a A G 7: 123,170,340 N451S possibly damaging Het
Trim36 T C 18: 46,196,251 T41A probably damaging Het
Trmt112 C A 19: 6,910,353 probably benign Het
Trpc4ap A G 2: 155,645,070 probably benign Het
Ttll7 C T 3: 146,939,991 P535S probably damaging Het
Ttn A T 2: 76,861,432 probably benign Het
Txndc11 C T 16: 11,128,500 R149Q probably benign Het
Ubr4 C T 4: 139,437,198 probably benign Het
Usp30 G A 5: 114,103,827 probably null Het
Vmn1r195 A G 13: 22,279,011 Y217C probably damaging Het
Vps33b T A 7: 80,282,486 D135E probably benign Het
Vrk2 A G 11: 26,483,331 probably benign Het
Wdr81 G T 11: 75,452,983 P486Q probably damaging Het
Zfp788 T C 7: 41,648,326 Y129H probably damaging Het
Other mutations in Fyco1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Fyco1 APN 9 123838897 missense probably damaging 1.00
IGL01407:Fyco1 APN 9 123828879 missense probably damaging 1.00
IGL01621:Fyco1 APN 9 123827182 unclassified probably benign
IGL01908:Fyco1 APN 9 123829230 missense probably damaging 1.00
IGL02006:Fyco1 APN 9 123829831 nonsense probably null
IGL02899:Fyco1 APN 9 123830331 missense possibly damaging 0.47
IGL03166:Fyco1 APN 9 123828387 missense probably benign 0.00
IGL03272:Fyco1 APN 9 123829603 missense probably benign 0.00
R0013:Fyco1 UTSW 9 123822406 missense probably benign
R0025:Fyco1 UTSW 9 123829009 missense probably damaging 1.00
R0349:Fyco1 UTSW 9 123797662 missense probably damaging 0.98
R0751:Fyco1 UTSW 9 123819153 missense probably damaging 1.00
R1563:Fyco1 UTSW 9 123827182 unclassified probably benign
R1618:Fyco1 UTSW 9 123829281 missense probably damaging 1.00
R1732:Fyco1 UTSW 9 123819092 missense probably benign 0.32
R1873:Fyco1 UTSW 9 123823238 missense probably benign
R1920:Fyco1 UTSW 9 123830413 missense probably damaging 1.00
R2108:Fyco1 UTSW 9 123797516 critical splice donor site probably null
R2849:Fyco1 UTSW 9 123834826 nonsense probably null
R2944:Fyco1 UTSW 9 123826648 missense probably benign 0.02
R4035:Fyco1 UTSW 9 123801283 missense probably benign 0.00
R4120:Fyco1 UTSW 9 123825626 missense probably benign 0.00
R4198:Fyco1 UTSW 9 123826634 missense probably benign
R4534:Fyco1 UTSW 9 123838888 missense probably damaging 1.00
R4535:Fyco1 UTSW 9 123838888 missense probably damaging 1.00
R4536:Fyco1 UTSW 9 123838888 missense probably damaging 1.00
R5408:Fyco1 UTSW 9 123829503 missense probably damaging 0.99
R5522:Fyco1 UTSW 9 123794771 nonsense probably null
R5755:Fyco1 UTSW 9 123828708 missense possibly damaging 0.71
R5781:Fyco1 UTSW 9 123794833 missense probably damaging 1.00
R5813:Fyco1 UTSW 9 123831348 missense probably damaging 1.00
R7090:Fyco1 UTSW 9 123797719 missense not run
Predicted Primers PCR Primer
(F):5'- GAGCACTGCAACTTTTCAAGAGCC -3'
(R):5'- ATCAGCTTGTTCTCCATAGCAGCAC -3'

Sequencing Primer
(F):5'- TGAACACTGTTCTGAGGCATC -3'
(R):5'- CATAGCAGCACCCTTCATTTC -3'
Posted On2014-01-15