Incidental Mutation 'R1184:2410089E03Rik'
ID101978
Institutional Source Beutler Lab
Gene Symbol 2410089E03Rik
Ensembl Gene ENSMUSG00000039801
Gene NameRIKEN cDNA 2410089E03 gene
Synonymsb2b012Clo
MMRRC Submission 039256-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1184 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location8169106-8271158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 8216487 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 1448 (V1448L)
Ref Sequence ENSEMBL: ENSMUSP00000106247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110617]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082632
Predicted Effect probably benign
Transcript: ENSMUST00000110617
AA Change: V1448L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106247
Gene: ENSMUSG00000039801
AA Change: V1448L

DomainStartEndE-ValueType
low complexity region 144 157 N/A INTRINSIC
low complexity region 338 352 N/A INTRINSIC
low complexity region 466 476 N/A INTRINSIC
low complexity region 868 883 N/A INTRINSIC
low complexity region 949 962 N/A INTRINSIC
low complexity region 1400 1415 N/A INTRINSIC
low complexity region 1449 1464 N/A INTRINSIC
low complexity region 1827 1838 N/A INTRINSIC
low complexity region 1919 1930 N/A INTRINSIC
low complexity region 2130 2145 N/A INTRINSIC
coiled coil region 2750 2782 N/A INTRINSIC
low complexity region 2838 2850 N/A INTRINSIC
Pfam:Joubert 2894 3207 1.9e-136 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154291
Meta Mutation Damage Score 0.0592 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. Defects in this gene are a cause of Joubert syndrome (JBTS). [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes exhibit double outlet right ventricle {SDD}, pulmonary atresia/hypolastic pulmonary artery, atrioventricular septal defect, and right aortic arch. Non-cardiovascular defects include cleft palate, polydactyly, transparent chest wall (sternal bone hypoplasia) and hypoplastic lungs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,160,912 R7G probably damaging Het
Ahdc1 T A 4: 133,065,396 M1316K probably benign Het
Alkal1 A G 1: 6,389,488 Y96C probably damaging Het
Arhgap17 T C 7: 123,314,690 Y199C probably damaging Het
Bmp2 T C 2: 133,561,468 V313A probably damaging Het
Cacna1b C T 2: 24,687,745 probably null Het
Cars T C 7: 143,587,139 T141A probably damaging Het
Ccdc57 A G 11: 120,873,811 probably benign Het
Cenpe T C 3: 135,264,422 probably null Het
Chadl T C 15: 81,693,057 S198G probably benign Het
Chd6 G C 2: 161,030,802 P286R probably damaging Het
Clec4a4 G T 6: 123,012,712 W104L probably benign Het
Coq4 G A 2: 29,788,334 probably benign Het
Crtc2 T A 3: 90,262,633 Y445* probably null Het
Dapk1 A T 13: 60,696,298 I44F probably damaging Het
Dcbld2 T A 16: 58,449,841 probably null Het
Dcun1d4 T C 5: 73,511,112 probably benign Het
Depdc7 A T 2: 104,730,178 probably benign Het
Dna2 A G 10: 62,959,198 D416G probably benign Het
Dnah2 A T 11: 69,499,190 I743N probably damaging Het
Dnah9 A G 11: 66,084,612 probably null Het
Dock3 A G 9: 106,969,800 S877P probably damaging Het
Eif3l T A 15: 79,075,766 probably null Het
Epha5 A T 5: 84,071,275 probably null Het
Ffar3 T A 7: 30,855,104 N264Y probably damaging Het
Fyb A T 15: 6,638,900 I525F probably damaging Het
Fyco1 A G 9: 123,819,153 F1239L probably damaging Het
Gcdh T C 8: 84,893,442 probably benign Het
Gk5 T C 9: 96,150,420 probably benign Het
Gm21188 A T 13: 120,035,131 N67K probably benign Het
Gm8979 A G 7: 106,083,952 V32A probably benign Het
Grm1 A G 10: 10,720,034 Y617H probably benign Het
Hhipl2 A T 1: 183,425,134 I131L probably damaging Het
Larp4b T C 13: 9,166,309 probably benign Het
Lrig2 T A 3: 104,490,911 I301F possibly damaging Het
Man2a2 A T 7: 80,362,965 I600N possibly damaging Het
Mylk2 G C 2: 152,913,741 probably null Het
Myo6 C T 9: 80,286,382 Q870* probably null Het
Napg T G 18: 62,994,338 H204Q probably benign Het
Neb G A 2: 52,263,947 T2384M probably damaging Het
Nek10 A G 14: 14,931,325 probably benign Het
Olfr1216 A G 2: 89,013,713 M117T probably damaging Het
Olfr1440 T C 19: 12,394,857 V198A probably benign Het
Olfr1462 T G 19: 13,191,375 L236R probably damaging Het
Olfr748 A C 14: 50,710,614 T95P probably benign Het
Pclo A G 5: 14,522,262 T554A unknown Het
Perm1 C A 4: 156,217,314 T105K probably damaging Het
Pik3r1 T C 13: 101,686,358 probably null Het
Pld5 A G 1: 176,044,896 I225T probably damaging Het
Plxnc1 T C 10: 94,831,333 probably benign Het
Ptpn12 A C 5: 20,998,356 S475A possibly damaging Het
Ptprt A G 2: 161,927,772 V391A possibly damaging Het
Rac2 T G 15: 78,565,945 D65A possibly damaging Het
Rgl3 A G 9: 21,977,380 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sebox A T 11: 78,503,849 T47S probably damaging Het
Sema4b A G 7: 80,224,640 T593A probably benign Het
Serpina3a C T 12: 104,116,528 Q187* probably null Het
Serpinb1a T C 13: 32,843,216 K248E probably benign Het
Serpinb9e A C 13: 33,259,774 E259A probably benign Het
Slc30a3 T A 5: 31,090,166 H44L probably damaging Het
Smarca2 T C 19: 26,770,933 probably benign Het
Snrnp200 T A 2: 127,236,817 C1801S probably damaging Het
Soat1 G A 1: 156,442,374 probably null Het
Spink6 T C 18: 44,071,538 probably benign Het
Spta1 G A 1: 174,184,690 R354H probably damaging Het
Tbck T A 3: 132,837,972 H861Q probably benign Het
Tgfbrap1 G A 1: 43,049,696 T849M possibly damaging Het
Tnrc6a A G 7: 123,170,340 N451S possibly damaging Het
Trim36 T C 18: 46,196,251 T41A probably damaging Het
Trmt112 C A 19: 6,910,353 probably benign Het
Trpc4ap A G 2: 155,645,070 probably benign Het
Ttll7 C T 3: 146,939,991 P535S probably damaging Het
Ttn A T 2: 76,861,432 probably benign Het
Txndc11 C T 16: 11,128,500 R149Q probably benign Het
Ubr4 C T 4: 139,437,198 probably benign Het
Usp30 G A 5: 114,103,827 probably null Het
Vmn1r195 A G 13: 22,279,011 Y217C probably damaging Het
Vps33b T A 7: 80,282,486 D135E probably benign Het
Vrk2 A G 11: 26,483,331 probably benign Het
Wdr81 G T 11: 75,452,983 P486Q probably damaging Het
Zfp788 T C 7: 41,648,326 Y129H probably damaging Het
Other mutations in 2410089E03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:2410089E03Rik APN 15 8264447 splice site probably benign
IGL00766:2410089E03Rik APN 15 8252164 missense unknown
IGL01483:2410089E03Rik APN 15 8187107 missense probably damaging 0.98
IGL01520:2410089E03Rik APN 15 8221911 missense probably damaging 0.96
IGL01578:2410089E03Rik APN 15 8270710 missense unknown
IGL01701:2410089E03Rik APN 15 8203257 splice site probably benign
IGL01892:2410089E03Rik APN 15 8242265 splice site probably benign
IGL01895:2410089E03Rik APN 15 8229107 missense possibly damaging 0.63
IGL01922:2410089E03Rik APN 15 8270821 missense unknown
IGL01978:2410089E03Rik APN 15 8219382 missense probably damaging 0.98
IGL02031:2410089E03Rik APN 15 8179769 missense probably damaging 0.99
IGL02318:2410089E03Rik APN 15 8175025 missense probably damaging 0.98
IGL02321:2410089E03Rik APN 15 8216572 missense probably benign 0.04
IGL02363:2410089E03Rik APN 15 8218437 missense possibly damaging 0.68
IGL02404:2410089E03Rik APN 15 8187284 missense possibly damaging 0.48
IGL02535:2410089E03Rik APN 15 8174838 missense probably damaging 1.00
IGL02732:2410089E03Rik APN 15 8179891 missense probably benign 0.03
IGL02895:2410089E03Rik APN 15 8232107 splice site probably benign
IGL02903:2410089E03Rik APN 15 8269778 missense unknown
IGL02903:2410089E03Rik APN 15 8269779 missense unknown
IGL02979:2410089E03Rik APN 15 8218554 missense possibly damaging 0.82
IGL03077:2410089E03Rik APN 15 8212795 splice site probably benign
IGL03196:2410089E03Rik APN 15 8201342 missense probably damaging 0.98
IGL03344:2410089E03Rik APN 15 8187458 missense possibly damaging 0.63
IGL03368:2410089E03Rik APN 15 8222373 missense probably benign 0.06
IGL03403:2410089E03Rik APN 15 8201342 missense probably damaging 0.98
agnes UTSW 15 8246938 nonsense probably null
dei UTSW 15 8186165 missense probably damaging 1.00
R0015:2410089E03Rik UTSW 15 8186184 missense probably damaging 1.00
R0015:2410089E03Rik UTSW 15 8186184 missense probably damaging 1.00
R0101:2410089E03Rik UTSW 15 8220960 missense probably benign 0.00
R0105:2410089E03Rik UTSW 15 8187392 missense probably benign
R0105:2410089E03Rik UTSW 15 8187392 missense probably benign
R0165:2410089E03Rik UTSW 15 8216382 missense probably damaging 1.00
R0306:2410089E03Rik UTSW 15 8179889 missense probably damaging 1.00
R0433:2410089E03Rik UTSW 15 8216562 missense probably benign 0.00
R0491:2410089E03Rik UTSW 15 8182243 missense probably damaging 1.00
R0523:2410089E03Rik UTSW 15 8194386 missense probably damaging 1.00
R0571:2410089E03Rik UTSW 15 8259793 missense unknown
R0679:2410089E03Rik UTSW 15 8223122 missense probably benign 0.39
R0704:2410089E03Rik UTSW 15 8210083 missense possibly damaging 0.93
R0707:2410089E03Rik UTSW 15 8258321 missense unknown
R0715:2410089E03Rik UTSW 15 8223092 missense probably benign 0.14
R0762:2410089E03Rik UTSW 15 8218416 unclassified probably benign
R0830:2410089E03Rik UTSW 15 8247185 missense unknown
R0924:2410089E03Rik UTSW 15 8251070 splice site probably benign
R1071:2410089E03Rik UTSW 15 8218426 missense probably benign 0.20
R1224:2410089E03Rik UTSW 15 8178385 missense probably benign 0.06
R1416:2410089E03Rik UTSW 15 8246938 nonsense probably null
R1428:2410089E03Rik UTSW 15 8219369 missense possibly damaging 0.83
R1487:2410089E03Rik UTSW 15 8186231 missense probably damaging 1.00
R1641:2410089E03Rik UTSW 15 8228959 missense probably benign 0.41
R1652:2410089E03Rik UTSW 15 8201146 missense probably damaging 1.00
R1688:2410089E03Rik UTSW 15 8228609 missense probably benign 0.00
R1715:2410089E03Rik UTSW 15 8226900 splice site probably null
R1820:2410089E03Rik UTSW 15 8269645 missense unknown
R1863:2410089E03Rik UTSW 15 8228593 missense probably benign 0.00
R1940:2410089E03Rik UTSW 15 8233852 missense probably damaging 0.98
R1967:2410089E03Rik UTSW 15 8203420 missense probably benign 0.09
R2064:2410089E03Rik UTSW 15 8186165 missense probably damaging 1.00
R2076:2410089E03Rik UTSW 15 8219257 missense possibly damaging 0.93
R2163:2410089E03Rik UTSW 15 8203251 splice site probably null
R2208:2410089E03Rik UTSW 15 8194403 missense probably benign 0.33
R2504:2410089E03Rik UTSW 15 8219216 missense probably damaging 0.99
R2568:2410089E03Rik UTSW 15 8201269 missense possibly damaging 0.70
R2845:2410089E03Rik UTSW 15 8216380 missense probably damaging 1.00
R2913:2410089E03Rik UTSW 15 8270685 missense unknown
R3056:2410089E03Rik UTSW 15 8251007 missense unknown
R3706:2410089E03Rik UTSW 15 8259816 missense unknown
R3707:2410089E03Rik UTSW 15 8259816 missense unknown
R3870:2410089E03Rik UTSW 15 8218464 missense probably damaging 0.98
R3877:2410089E03Rik UTSW 15 8221943 missense probably benign
R3886:2410089E03Rik UTSW 15 8171805 missense probably damaging 0.98
R4057:2410089E03Rik UTSW 15 8219025 missense probably benign 0.08
R4090:2410089E03Rik UTSW 15 8212358 splice site probably null
R4362:2410089E03Rik UTSW 15 8270745 missense unknown
R4363:2410089E03Rik UTSW 15 8270745 missense unknown
R4445:2410089E03Rik UTSW 15 8252188 missense unknown
R4581:2410089E03Rik UTSW 15 8171798 missense possibly damaging 0.85
R4587:2410089E03Rik UTSW 15 8201152 missense possibly damaging 0.50
R4659:2410089E03Rik UTSW 15 8216276 intron probably benign
R4663:2410089E03Rik UTSW 15 8218455 missense probably benign 0.31
R4779:2410089E03Rik UTSW 15 8218838 missense probably benign 0.04
R4812:2410089E03Rik UTSW 15 8201123 splice site probably null
R4850:2410089E03Rik UTSW 15 8262938 missense unknown
R4896:2410089E03Rik UTSW 15 8221937 missense probably benign 0.00
R5273:2410089E03Rik UTSW 15 8244341 missense probably damaging 0.98
R5273:2410089E03Rik UTSW 15 8262938 missense unknown
R5303:2410089E03Rik UTSW 15 8260690 splice site probably null
R5307:2410089E03Rik UTSW 15 8260690 splice site probably null
R5308:2410089E03Rik UTSW 15 8260690 splice site probably null
R5373:2410089E03Rik UTSW 15 8270803 missense unknown
R5374:2410089E03Rik UTSW 15 8270803 missense unknown
R5386:2410089E03Rik UTSW 15 8194413 missense probably damaging 1.00
R5534:2410089E03Rik UTSW 15 8228835 missense probably benign 0.06
R5720:2410089E03Rik UTSW 15 8203687 missense probably benign 0.35
R5891:2410089E03Rik UTSW 15 8188589 missense probably benign 0.00
R5932:2410089E03Rik UTSW 15 8244595 splice site probably null
R6053:2410089E03Rik UTSW 15 8188461 missense probably benign 0.35
R6166:2410089E03Rik UTSW 15 8186560 missense probably benign 0.00
R6245:2410089E03Rik UTSW 15 8178418 missense probably benign 0.01
R6246:2410089E03Rik UTSW 15 8210014 missense probably damaging 1.00
R6541:2410089E03Rik UTSW 15 8219295 missense possibly damaging 0.48
R6622:2410089E03Rik UTSW 15 8244222 missense probably damaging 0.98
R6707:2410089E03Rik UTSW 15 8223122 missense probably benign 0.39
R6729:2410089E03Rik UTSW 15 8188601 splice site probably null
R6805:2410089E03Rik UTSW 15 8244306 missense probably benign 0.07
R6806:2410089E03Rik UTSW 15 8186858 missense possibly damaging 0.55
R6813:2410089E03Rik UTSW 15 8229282 missense probably benign
R6830:2410089E03Rik UTSW 15 8176184 missense probably benign 0.04
R6845:2410089E03Rik UTSW 15 8221904 missense possibly damaging 0.84
R6894:2410089E03Rik UTSW 15 8187368 missense probably damaging 0.99
R6970:2410089E03Rik UTSW 15 8187548 missense probably benign 0.01
U24488:2410089E03Rik UTSW 15 8182210 missense probably damaging 1.00
X0023:2410089E03Rik UTSW 15 8247031 missense unknown
Predicted Primers PCR Primer
(F):5'- TGAACCATGAGGACTTTGGTTTCCC -3'
(R):5'- TGCCCAGTGAGTTACAGAGGTTGC -3'

Sequencing Primer
(F):5'- GGTTTCCCCAGGTCCTCAG -3'
(R):5'- GAGTTACAGAGGTTGCCCTCTAC -3'
Posted On2014-01-15