Incidental Mutation 'R1185:Sfi1'
ID102054
Institutional Source Beutler Lab
Gene Symbol Sfi1
Ensembl Gene ENSMUSG00000023764
Gene NameSfi1 homolog, spindle assembly associated (yeast)
Synonyms
MMRRC Submission 039257-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R1185 (G1)
Quality Score217
Status Not validated
Chromosome11
Chromosomal Location3131850-3193463 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TCGC to TC at 3146254 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066391] [ENSMUST00000081318] [ENSMUST00000101655] [ENSMUST00000132893] [ENSMUST00000140846] [ENSMUST00000153425]
Predicted Effect probably null
Transcript: ENSMUST00000066391
SMART Domains Protein: ENSMUSP00000067261
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
internal_repeat_2 34 236 4.95e-5 PROSPERO
internal_repeat_1 78 336 3.02e-14 PROSPERO
low complexity region 342 358 N/A INTRINSIC
internal_repeat_1 372 636 3.02e-14 PROSPERO
internal_repeat_2 574 804 4.95e-5 PROSPERO
low complexity region 809 821 N/A INTRINSIC
low complexity region 849 860 N/A INTRINSIC
coiled coil region 1086 1112 N/A INTRINSIC
coiled coil region 1138 1168 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000081318
SMART Domains Protein: ENSMUSP00000080066
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
internal_repeat_3 55 275 2e-6 PROSPERO
internal_repeat_1 67 288 7.56e-9 PROSPERO
internal_repeat_2 93 401 1.18e-6 PROSPERO
internal_repeat_3 380 607 2e-6 PROSPERO
internal_repeat_1 428 651 7.56e-9 PROSPERO
internal_repeat_2 524 836 1.18e-6 PROSPERO
low complexity region 841 853 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
coiled coil region 1118 1144 N/A INTRINSIC
coiled coil region 1170 1200 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000101655
SMART Domains Protein: ENSMUSP00000099178
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
internal_repeat_3 55 275 1.77e-6 PROSPERO
internal_repeat_1 67 288 6.51e-9 PROSPERO
internal_repeat_2 93 401 1.04e-6 PROSPERO
internal_repeat_3 380 607 1.77e-6 PROSPERO
internal_repeat_1 428 651 6.51e-9 PROSPERO
internal_repeat_2 524 836 1.04e-6 PROSPERO
low complexity region 841 853 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
coiled coil region 1107 1133 N/A INTRINSIC
coiled coil region 1159 1189 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120853
Predicted Effect probably null
Transcript: ENSMUST00000126746
SMART Domains Protein: ENSMUSP00000122002
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
low complexity region 73 89 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131021
Predicted Effect probably null
Transcript: ENSMUST00000132893
SMART Domains Protein: ENSMUSP00000118419
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
low complexity region 210 223 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138126
Predicted Effect probably null
Transcript: ENSMUST00000140846
SMART Domains Protein: ENSMUSP00000119905
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
internal_repeat_1 3 301 3.65e-15 PROSPERO
internal_repeat_2 12 320 8.53e-7 PROSPERO
internal_repeat_1 301 599 3.65e-15 PROSPERO
internal_repeat_2 443 755 8.53e-7 PROSPERO
low complexity region 760 772 N/A INTRINSIC
low complexity region 800 811 N/A INTRINSIC
coiled coil region 1026 1052 N/A INTRINSIC
coiled coil region 1078 1108 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146888
Predicted Effect probably null
Transcript: ENSMUST00000153425
SMART Domains Protein: ENSMUSP00000121719
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
internal_repeat_1 67 288 6.06e-9 PROSPERO
internal_repeat_3 69 314 2.4e-5 PROSPERO
internal_repeat_2 93 340 2.83e-6 PROSPERO
low complexity region 342 358 N/A INTRINSIC
internal_repeat_1 397 620 6.06e-9 PROSPERO
internal_repeat_2 493 744 2.83e-6 PROSPERO
internal_repeat_3 531 799 2.4e-5 PROSPERO
low complexity region 810 822 N/A INTRINSIC
low complexity region 850 861 N/A INTRINSIC
coiled coil region 1076 1102 N/A INTRINSIC
coiled coil region 1128 1158 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 96.3%
  • 10x: 87.8%
  • 20x: 68.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aimp2 A G 5: 143,904,691 S110P possibly damaging Het
Akap9 A G 5: 3,948,783 T51A probably benign Het
Arhgef25 A G 10: 127,183,781 F430L possibly damaging Het
Brap T C 5: 121,675,279 V235A probably damaging Het
Cd69 C T 6: 129,270,185 G23D probably damaging Het
Cecr2 C T 6: 120,758,205 R24* probably null Het
Celsr2 T C 3: 108,399,709 D1974G possibly damaging Het
Cps1 A G 1: 67,195,199 K915R probably benign Het
Csmd1 T C 8: 16,358,348 D401G probably damaging Het
Dusp13 A G 14: 21,735,018 F141S probably damaging Het
Fam162b A G 10: 51,590,343 W27R probably benign Het
Focad A G 4: 88,178,187 T269A probably benign Het
Ghr T A 15: 3,328,062 R241S possibly damaging Het
Gm21319 A G 12: 87,773,708 V27A probably benign Het
Hirip3 AAGAG AAG 7: 126,863,660 probably null Het
Itgb2l A G 16: 96,429,040 Y357H possibly damaging Het
Jrkl T C 9: 13,244,933 D241G possibly damaging Het
Lmod1 A G 1: 135,364,229 D274G probably benign Het
Lrrn2 A G 1: 132,939,221 S675G probably benign Het
Ltbp4 G C 7: 27,310,535 P1200R probably damaging Het
Mdn1 T C 4: 32,735,576 L3414P possibly damaging Het
Myo16 T A 8: 10,633,624 S1856T probably damaging Het
Neb A G 2: 52,296,298 Y921H probably damaging Het
Olfr135 T A 17: 38,209,183 *313R probably null Het
Pgap3 T C 11: 98,391,134 D117G probably damaging Het
Ppp1r9b T C 11: 95,001,986 F671L possibly damaging Het
Proser3 G A 7: 30,546,147 A144V probably benign Het
Purg T G 8: 33,386,869 Y178* probably null Het
Sorbs1 T A 19: 40,382,606 D79V probably damaging Het
Tcaf3 T C 6: 42,591,434 T663A probably damaging Het
Timd4 C A 11: 46,817,648 T167K probably damaging Het
Tjp2 A G 19: 24,131,163 L195P possibly damaging Het
Tnr G A 1: 159,852,286 A277T probably benign Het
Ttc30a1 A T 2: 75,980,352 N462K probably damaging Het
Unc13a C T 8: 71,661,833 G181D probably benign Het
Vmn1r11 T A 6: 57,137,507 L52Q possibly damaging Het
Vmn2r125 C A 4: 156,351,101 A258D probably benign Het
Zfp27 T C 7: 29,895,829 D237G possibly damaging Het
Zfp39 T C 11: 58,902,844 T23A possibly damaging Het
Zfp459 T G 13: 67,408,481 N161T probably benign Het
Other mutations in Sfi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Sfi1 APN 11 3134337 missense probably benign 0.05
IGL00990:Sfi1 APN 11 3135671 missense probably damaging 0.99
IGL00990:Sfi1 APN 11 3143689 splice site probably benign
IGL03147:Sfi1 UTSW 11 3186080 missense possibly damaging 0.94
R0081:Sfi1 UTSW 11 3146254 frame shift probably null
R0082:Sfi1 UTSW 11 3146254 frame shift probably null
R0118:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R0197:Sfi1 UTSW 11 3146254 frame shift probably null
R0241:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R0241:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R0242:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R0816:Sfi1 UTSW 11 3146254 frame shift probably null
R1147:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1148:Sfi1 UTSW 11 3146254 frame shift probably null
R1148:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1185:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1207:Sfi1 UTSW 11 3146254 frame shift probably null
R1207:Sfi1 UTSW 11 3146255 frame shift probably null
R1207:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1403:Sfi1 UTSW 11 3146254 frame shift probably null
R1403:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1404:Sfi1 UTSW 11 3146254 frame shift probably null
R1404:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1405:Sfi1 UTSW 11 3146254 frame shift probably null
R1405:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1465:Sfi1 UTSW 11 3146254 frame shift probably null
R1469:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1470:Sfi1 UTSW 11 3146254 frame shift probably null
R1470:Sfi1 UTSW 11 3146255 frame shift probably null
R1574:Sfi1 UTSW 11 3146254 frame shift probably null
R2871:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R5228:Sfi1 UTSW 11 3153384 intron probably benign
R5276:Sfi1 UTSW 11 3153384 intron probably benign
R5298:Sfi1 UTSW 11 3153384 intron probably benign
R5343:Sfi1 UTSW 11 3153384 intron probably benign
R5376:Sfi1 UTSW 11 3153384 intron probably benign
R5384:Sfi1 UTSW 11 3153382 intron probably benign
R5385:Sfi1 UTSW 11 3153382 intron probably benign
R5386:Sfi1 UTSW 11 3153384 intron probably benign
R5411:Sfi1 UTSW 11 3153384 intron probably benign
R5431:Sfi1 UTSW 11 3153384 intron probably benign
R5795:Sfi1 UTSW 11 3153384 intron probably benign
R5808:Sfi1 UTSW 11 3153384 intron probably benign
Predicted Primers PCR Primer
(F):5'- GTCCCAGGAGAAAGTACCGGCTAA -3'
(R):5'- ACCTAGCAAACTGGTGAAGATCAAACAT -3'

Sequencing Primer
(F):5'- TGAGATCAAAAGGCCCTCATTCTG -3'
(R):5'- CAAACATAACACTTCATTCTGTTCC -3'
Posted On2014-01-15