Incidental Mutation 'R1186:Vmn2r6'
ID102096
Institutional Source Beutler Lab
Gene Symbol Vmn2r6
Ensembl Gene ENSMUSG00000090581
Gene Namevomeronasal 2, receptor 6
SynonymsEG620718, EG667069
MMRRC Submission 039258-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.572) question?
Stock #R1186 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location64537561-64565298 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 64565067 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 78 (M78L)
Ref Sequence ENSEMBL: ENSMUSP00000135148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176481]
Predicted Effect probably benign
Transcript: ENSMUST00000176481
AA Change: M78L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000135148
Gene: ENSMUSG00000090581
AA Change: M78L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 88 505 9.8e-77 PFAM
Pfam:Peripla_BP_6 142 331 3.4e-10 PFAM
Pfam:NCD3G 547 600 5.4e-17 PFAM
Pfam:7tm_3 633 867 3.9e-47 PFAM
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 97% (69/71)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik G A 10: 21,621,652 R64Q probably benign Het
4932438A13Rik T C 3: 36,996,312 probably benign Het
9530068E07Rik G A 11: 52,403,078 V49I probably benign Het
A2m T C 6: 121,661,534 S902P probably benign Het
Aatf A T 11: 84,470,549 probably benign Het
Adamtsl1 A G 4: 86,388,509 T1395A probably benign Het
Alpk2 T C 18: 65,294,341 probably null Het
Ank3 G T 10: 69,867,460 A308S probably damaging Het
Arap1 A G 7: 101,404,269 probably benign Het
C4b T C 17: 34,736,309 D769G possibly damaging Het
Cep350 A G 1: 155,875,376 S2017P probably damaging Het
Cfap54 T A 10: 92,875,994 I2704F unknown Het
Crip2 G A 12: 113,144,959 probably benign Het
Cyp4f14 T C 17: 32,916,786 I34V probably benign Het
Dcstamp A G 15: 39,754,629 probably null Het
Ddx5 T C 11: 106,783,979 probably null Het
Dnah2 A T 11: 69,515,700 L572Q probably damaging Het
Espl1 G A 15: 102,304,039 A527T probably benign Het
Fam83d A G 2: 158,785,174 D261G probably damaging Het
Fbxo34 T C 14: 47,530,586 F468L probably damaging Het
Gabarapl1 A T 6: 129,533,405 probably benign Het
Galnt17 G T 5: 131,111,742 T179K probably damaging Het
Gm6768 A C 12: 119,261,471 noncoding transcript Het
Gm6899 C T 11: 26,593,685 probably benign Het
Helz2 T A 2: 181,231,128 R2433W probably damaging Het
Hivep3 T C 4: 119,814,723 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ica1 A G 6: 8,672,326 L225P probably damaging Het
Inpp5f T C 7: 128,694,583 I195T probably benign Het
Isyna1 C A 8: 70,595,201 N115K probably benign Het
Ly6g6e T C 17: 35,078,008 F75S probably benign Het
Ly96 A G 1: 16,700,894 D101G possibly damaging Het
Mapk9 A G 11: 49,878,269 T243A probably damaging Het
Mcc A G 18: 44,759,403 V48A probably benign Het
Mcpt2 C T 14: 56,043,945 probably benign Het
Med24 T C 11: 98,717,757 probably benign Het
Mtbp G A 15: 55,564,671 G162S probably null Het
Mtfr2 G A 10: 20,352,852 C48Y probably benign Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Naip2 AGGG AGG 13: 100,162,037 probably null Het
Nup107 A C 10: 117,777,146 Y292* probably null Het
Nwd2 C T 5: 63,650,024 probably benign Het
Nxpe4 A C 9: 48,393,392 N260H probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1084 A T 2: 86,639,463 L82M probably damaging Het
Olfr5 T C 7: 6,480,542 I205V probably benign Het
Olfr901 T C 9: 38,431,101 V273A possibly damaging Het
Olfr911-ps1 T C 9: 38,524,157 S142P probably damaging Het
P2rx7 T C 5: 122,670,451 Y299H probably damaging Het
Per3 T A 4: 151,026,138 E401V probably damaging Het
Rbm34 C A 8: 126,965,447 E182* probably null Het
Sdk2 C T 11: 113,838,646 silent Het
Senp2 T C 16: 22,011,504 S38P probably damaging Het
Slc36a2 A T 11: 55,164,231 probably null Het
Spred1 A T 2: 117,177,697 R361S possibly damaging Het
Spry2 A G 14: 105,892,907 C282R probably damaging Het
Srp54b T C 12: 55,255,528 probably benign Het
Taar8c G C 10: 24,101,565 Y116* probably null Het
Tchh C G 3: 93,448,046 R1598G unknown Het
Tex15 A G 8: 33,571,633 M364V probably benign Het
Ttbk1 T C 17: 46,467,131 R662G probably damaging Het
Ttc5 G A 14: 50,767,226 Q374* probably null Het
Usp46 C T 5: 74,002,122 A312T probably benign Het
Vmn1r176 A T 7: 23,835,626 L34Q probably damaging Het
Vmn1r178 A T 7: 23,893,892 R122* probably null Het
Zfp407 A T 18: 84,209,448 I2012N probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Zfyve26 G A 12: 79,263,949 L161F probably damaging Het
Other mutations in Vmn2r6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Vmn2r6 APN 3 64538104 missense probably damaging 1.00
IGL01968:Vmn2r6 APN 3 64556345 missense possibly damaging 0.94
IGL02009:Vmn2r6 APN 3 64537902 missense possibly damaging 0.61
IGL02039:Vmn2r6 APN 3 64556189 missense probably damaging 1.00
IGL02652:Vmn2r6 APN 3 64556328 missense probably benign 0.24
IGL02737:Vmn2r6 APN 3 64556490 missense possibly damaging 0.55
IGL02808:Vmn2r6 APN 3 64556496 missense probably damaging 1.00
IGL03066:Vmn2r6 APN 3 64565153 missense probably damaging 0.99
IGL03331:Vmn2r6 APN 3 64538007 missense probably damaging 1.00
R0010:Vmn2r6 UTSW 3 64559545 nonsense probably null
R0206:Vmn2r6 UTSW 3 64539912 missense probably benign
R0206:Vmn2r6 UTSW 3 64539912 missense probably benign
R0208:Vmn2r6 UTSW 3 64539912 missense probably benign
R0427:Vmn2r6 UTSW 3 64559587 missense probably damaging 1.00
R0466:Vmn2r6 UTSW 3 64556302 missense probably damaging 1.00
R1018:Vmn2r6 UTSW 3 64556840 missense probably benign 0.00
R1104:Vmn2r6 UTSW 3 64538066 missense possibly damaging 0.93
R1245:Vmn2r6 UTSW 3 64556790 missense possibly damaging 0.53
R1295:Vmn2r6 UTSW 3 64538273 missense probably damaging 1.00
R1473:Vmn2r6 UTSW 3 64538158 nonsense probably null
R1498:Vmn2r6 UTSW 3 64556469 missense probably damaging 1.00
R1925:Vmn2r6 UTSW 3 64556277 missense possibly damaging 0.87
R2044:Vmn2r6 UTSW 3 64537841 missense probably damaging 0.96
R2069:Vmn2r6 UTSW 3 64556098 missense possibly damaging 0.89
R2253:Vmn2r6 UTSW 3 64559718 missense probably damaging 1.00
R2261:Vmn2r6 UTSW 3 64556669 missense probably benign 0.24
R2262:Vmn2r6 UTSW 3 64556669 missense probably benign 0.24
R2350:Vmn2r6 UTSW 3 64556352 missense probably benign 0.01
R2680:Vmn2r6 UTSW 3 64538286 missense possibly damaging 0.91
R2846:Vmn2r6 UTSW 3 64556790 missense possibly damaging 0.53
R2860:Vmn2r6 UTSW 3 64547339 missense probably benign 0.00
R2861:Vmn2r6 UTSW 3 64547339 missense probably benign 0.00
R3766:Vmn2r6 UTSW 3 64556508 missense probably benign 0.19
R3870:Vmn2r6 UTSW 3 64556621 missense probably damaging 0.96
R4018:Vmn2r6 UTSW 3 64556472 missense probably benign 0.05
R4024:Vmn2r6 UTSW 3 64538250 missense possibly damaging 0.73
R4026:Vmn2r6 UTSW 3 64538250 missense possibly damaging 0.73
R4227:Vmn2r6 UTSW 3 64537948 missense probably damaging 0.99
R4526:Vmn2r6 UTSW 3 64537724 missense probably benign 0.32
R4570:Vmn2r6 UTSW 3 64559647 missense probably benign 0.31
R4894:Vmn2r6 UTSW 3 64547408 missense probably benign
R4934:Vmn2r6 UTSW 3 64556345 missense probably damaging 0.99
R5057:Vmn2r6 UTSW 3 64537786 missense probably damaging 1.00
R5059:Vmn2r6 UTSW 3 64537623 missense possibly damaging 0.89
R5148:Vmn2r6 UTSW 3 64556594 missense probably damaging 0.99
R5155:Vmn2r6 UTSW 3 64538514 missense probably benign 0.44
R5179:Vmn2r6 UTSW 3 64537990 missense probably benign 0.00
R5256:Vmn2r6 UTSW 3 64556842 missense probably benign 0.33
R5861:Vmn2r6 UTSW 3 64556033 missense probably benign 0.00
R5950:Vmn2r6 UTSW 3 64565231 missense probably benign 0.05
R6081:Vmn2r6 UTSW 3 64556532 missense probably benign 0.25
R6173:Vmn2r6 UTSW 3 64559755 missense probably damaging 1.00
R6190:Vmn2r6 UTSW 3 64538003 missense probably benign 0.04
R6240:Vmn2r6 UTSW 3 64556805 missense probably damaging 1.00
R6433:Vmn2r6 UTSW 3 64547380 nonsense probably null
R6645:Vmn2r6 UTSW 3 64556876 missense probably damaging 1.00
R6791:Vmn2r6 UTSW 3 64538159 missense probably damaging 1.00
X0020:Vmn2r6 UTSW 3 64538450 missense probably benign
X0066:Vmn2r6 UTSW 3 64547378 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCACAAGGAGCTGCCACAGG -3'
(R):5'- AGCTGCCAGTGCCAAACAAGAG -3'

Sequencing Primer
(F):5'- TGCCACAGGCTTCTGAGATG -3'
(R):5'- CAAGTGACTGCAACATCTGTGTC -3'
Posted On2014-01-15