Incidental Mutation 'R1186:Zfp407'
ID102209
Institutional Source Beutler Lab
Gene Symbol Zfp407
Ensembl Gene ENSMUSG00000048410
Gene Namezinc finger protein 407
Synonyms6430585N13Rik, LOC240469, LOC381139
MMRRC Submission 039258-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1186 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location84128027-84589725 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84209448 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 2012 (I2012N)
Ref Sequence ENSEMBL: ENSMUSP00000118361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000125763]
Predicted Effect probably benign
Transcript: ENSMUST00000125450
Predicted Effect probably benign
Transcript: ENSMUST00000125763
AA Change: I2012N

PolyPhen 2 Score 0.392 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000118361
Gene: ENSMUSG00000048410
AA Change: I2012N

DomainStartEndE-ValueType
low complexity region 20 37 N/A INTRINSIC
ZnF_C2H2 178 200 8.67e-1 SMART
ZnF_U1 233 267 6.79e-1 SMART
ZnF_C2H2 236 260 4.65e-1 SMART
ZnF_C2H2 522 545 7.05e-1 SMART
ZnF_U1 548 582 1.54e1 SMART
ZnF_C2H2 551 575 1.01e-1 SMART
ZnF_C2H2 582 605 1.41e0 SMART
ZnF_U1 606 639 2.22e0 SMART
ZnF_C2H2 609 632 1.01e2 SMART
ZnF_C2H2 695 718 6.23e-2 SMART
ZnF_U1 721 755 2.96e0 SMART
ZnF_C2H2 724 748 7.11e0 SMART
ZnF_C2H2 840 863 7.55e-1 SMART
ZnF_U1 866 900 3.81e-1 SMART
ZnF_C2H2 869 893 1.07e0 SMART
ZnF_C2H2 1009 1032 6.13e-1 SMART
ZnF_U1 1035 1069 2.22e0 SMART
ZnF_C2H2 1038 1062 5.62e0 SMART
low complexity region 1223 1234 N/A INTRINSIC
ZnF_C2H2 1405 1428 5.92e0 SMART
ZnF_U1 1432 1466 2.35e0 SMART
ZnF_C2H2 1435 1459 1.76e-1 SMART
ZnF_C2H2 1477 1500 5.42e-2 SMART
ZnF_C2H2 1528 1552 1.68e1 SMART
ZnF_C2H2 1558 1580 1.43e-1 SMART
ZnF_C2H2 1586 1609 9.58e-3 SMART
ZnF_C2H2 1619 1641 2.61e-4 SMART
ZnF_C2H2 1647 1671 1.04e-3 SMART
ZnF_C2H2 1677 1699 9.44e-2 SMART
ZnF_C2H2 1705 1727 1.82e-3 SMART
ZnF_C2H2 1733 1758 4.65e-1 SMART
ZnF_C2H2 1764 1787 1.26e-2 SMART
low complexity region 1876 1887 N/A INTRINSIC
low complexity region 2017 2032 N/A INTRINSIC
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein whose exact function is not known. It may be involved in transcriptional regulation. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik G A 10: 21,621,652 R64Q probably benign Het
4932438A13Rik T C 3: 36,996,312 probably benign Het
9530068E07Rik G A 11: 52,403,078 V49I probably benign Het
A2m T C 6: 121,661,534 S902P probably benign Het
Aatf A T 11: 84,470,549 probably benign Het
Adamtsl1 A G 4: 86,388,509 T1395A probably benign Het
Alpk2 T C 18: 65,294,341 probably null Het
Ank3 G T 10: 69,867,460 A308S probably damaging Het
Arap1 A G 7: 101,404,269 probably benign Het
C4b T C 17: 34,736,309 D769G possibly damaging Het
Cep350 A G 1: 155,875,376 S2017P probably damaging Het
Cfap54 T A 10: 92,875,994 I2704F unknown Het
Crip2 G A 12: 113,144,959 probably benign Het
Cyp4f14 T C 17: 32,916,786 I34V probably benign Het
Dcstamp A G 15: 39,754,629 probably null Het
Ddx5 T C 11: 106,783,979 probably null Het
Dnah2 A T 11: 69,515,700 L572Q probably damaging Het
Espl1 G A 15: 102,304,039 A527T probably benign Het
Fam83d A G 2: 158,785,174 D261G probably damaging Het
Fbxo34 T C 14: 47,530,586 F468L probably damaging Het
Gabarapl1 A T 6: 129,533,405 probably benign Het
Galnt17 G T 5: 131,111,742 T179K probably damaging Het
Gm6768 A C 12: 119,261,471 noncoding transcript Het
Gm6899 C T 11: 26,593,685 probably benign Het
Helz2 T A 2: 181,231,128 R2433W probably damaging Het
Hivep3 T C 4: 119,814,723 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ica1 A G 6: 8,672,326 L225P probably damaging Het
Inpp5f T C 7: 128,694,583 I195T probably benign Het
Isyna1 C A 8: 70,595,201 N115K probably benign Het
Ly6g6e T C 17: 35,078,008 F75S probably benign Het
Ly96 A G 1: 16,700,894 D101G possibly damaging Het
Mapk9 A G 11: 49,878,269 T243A probably damaging Het
Mcc A G 18: 44,759,403 V48A probably benign Het
Mcpt2 C T 14: 56,043,945 probably benign Het
Med24 T C 11: 98,717,757 probably benign Het
Mtbp G A 15: 55,564,671 G162S probably null Het
Mtfr2 G A 10: 20,352,852 C48Y probably benign Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Naip2 AGGG AGG 13: 100,162,037 probably null Het
Nup107 A C 10: 117,777,146 Y292* probably null Het
Nwd2 C T 5: 63,650,024 probably benign Het
Nxpe4 A C 9: 48,393,392 N260H probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1084 A T 2: 86,639,463 L82M probably damaging Het
Olfr5 T C 7: 6,480,542 I205V probably benign Het
Olfr901 T C 9: 38,431,101 V273A possibly damaging Het
Olfr911-ps1 T C 9: 38,524,157 S142P probably damaging Het
P2rx7 T C 5: 122,670,451 Y299H probably damaging Het
Per3 T A 4: 151,026,138 E401V probably damaging Het
Rbm34 C A 8: 126,965,447 E182* probably null Het
Sdk2 C T 11: 113,838,646 silent Het
Senp2 T C 16: 22,011,504 S38P probably damaging Het
Slc36a2 A T 11: 55,164,231 probably null Het
Spred1 A T 2: 117,177,697 R361S possibly damaging Het
Spry2 A G 14: 105,892,907 C282R probably damaging Het
Srp54b T C 12: 55,255,528 probably benign Het
Taar8c G C 10: 24,101,565 Y116* probably null Het
Tchh C G 3: 93,448,046 R1598G unknown Het
Tex15 A G 8: 33,571,633 M364V probably benign Het
Ttbk1 T C 17: 46,467,131 R662G probably damaging Het
Ttc5 G A 14: 50,767,226 Q374* probably null Het
Usp46 C T 5: 74,002,122 A312T probably benign Het
Vmn1r176 A T 7: 23,835,626 L34Q probably damaging Het
Vmn1r178 A T 7: 23,893,892 R122* probably null Het
Vmn2r6 T A 3: 64,565,067 M78L probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Zfyve26 G A 12: 79,263,949 L161F probably damaging Het
Other mutations in Zfp407
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Zfp407 APN 18 84561752 missense probably damaging 0.99
IGL02105:Zfp407 APN 18 84562720 nonsense probably null
IGL02110:Zfp407 APN 18 84559040 missense probably benign 0.00
IGL02343:Zfp407 APN 18 84209724 missense possibly damaging 0.71
IGL02456:Zfp407 APN 18 84558641 missense probably damaging 1.00
IGL02705:Zfp407 APN 18 84559031 nonsense probably null
IGL02946:Zfp407 APN 18 84560709 missense probably damaging 1.00
IGL03069:Zfp407 APN 18 84350975 missense probably damaging 1.00
IGL03145:Zfp407 APN 18 84209721 missense probably damaging 0.99
IGL03403:Zfp407 APN 18 84560797 missense probably damaging 1.00
IGL03134:Zfp407 UTSW 18 84209955 missense probably damaging 0.99
PIT4362001:Zfp407 UTSW 18 84561268 missense possibly damaging 0.87
PIT4520001:Zfp407 UTSW 18 84432420 missense probably damaging 0.99
R0087:Zfp407 UTSW 18 84560411 missense probably damaging 1.00
R0243:Zfp407 UTSW 18 84558711 missense probably damaging 1.00
R0594:Zfp407 UTSW 18 84562567 missense possibly damaging 0.87
R0766:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R0787:Zfp407 UTSW 18 84209022 missense probably damaging 1.00
R0787:Zfp407 UTSW 18 84209346 missense probably benign 0.00
R1065:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1086:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1165:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1203:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1312:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1345:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1385:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1421:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1430:Zfp407 UTSW 18 84209455 missense probably benign 0.18
R1436:Zfp407 UTSW 18 84343071 splice site probably benign
R1498:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1526:Zfp407 UTSW 18 84561033 missense possibly damaging 0.61
R1579:Zfp407 UTSW 18 84209638 missense probably benign 0.00
R1594:Zfp407 UTSW 18 84209331 missense probably benign 0.01
R1628:Zfp407 UTSW 18 84354533 missense probably damaging 1.00
R1698:Zfp407 UTSW 18 84562157 missense probably damaging 1.00
R1962:Zfp407 UTSW 18 84559336 missense probably benign 0.01
R1984:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1985:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1986:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R2151:Zfp407 UTSW 18 84209649 missense possibly damaging 0.55
R2152:Zfp407 UTSW 18 84209649 missense possibly damaging 0.55
R2154:Zfp407 UTSW 18 84209649 missense possibly damaging 0.55
R2259:Zfp407 UTSW 18 84209793 missense probably damaging 1.00
R2353:Zfp407 UTSW 18 84559880 missense probably damaging 1.00
R2845:Zfp407 UTSW 18 84558397 nonsense probably null
R3407:Zfp407 UTSW 18 84558872 missense probably benign 0.08
R3432:Zfp407 UTSW 18 84208746 missense probably damaging 1.00
R3892:Zfp407 UTSW 18 84560352 missense probably damaging 1.00
R4026:Zfp407 UTSW 18 84559596 missense possibly damaging 0.82
R4107:Zfp407 UTSW 18 84343007 missense possibly damaging 0.82
R4398:Zfp407 UTSW 18 84562731 nonsense probably null
R4447:Zfp407 UTSW 18 84562694 missense possibly damaging 0.95
R4752:Zfp407 UTSW 18 84562914 missense probably benign 0.01
R4881:Zfp407 UTSW 18 84559703 missense probably benign 0.27
R4936:Zfp407 UTSW 18 84559464 missense probably benign 0.00
R5194:Zfp407 UTSW 18 84561309 missense probably benign 0.05
R5243:Zfp407 UTSW 18 84561091 missense probably damaging 1.00
R5258:Zfp407 UTSW 18 84315926 missense probably damaging 1.00
R5591:Zfp407 UTSW 18 84561137 missense probably damaging 1.00
R5633:Zfp407 UTSW 18 84561044 missense probably benign 0.35
R5739:Zfp407 UTSW 18 84208742 makesense probably null
R5806:Zfp407 UTSW 18 84558614 missense probably damaging 1.00
R5820:Zfp407 UTSW 18 84560524 missense probably benign 0.01
R6187:Zfp407 UTSW 18 84559009 missense possibly damaging 0.87
R6512:Zfp407 UTSW 18 84560349 missense probably damaging 1.00
R6521:Zfp407 UTSW 18 84432411 missense probably damaging 1.00
R6748:Zfp407 UTSW 18 84208830 missense probably damaging 0.98
R6882:Zfp407 UTSW 18 84343069 splice site probably null
R6899:Zfp407 UTSW 18 84561434 missense possibly damaging 0.86
R7038:Zfp407 UTSW 18 84561857 missense probably damaging 1.00
R7076:Zfp407 UTSW 18 84558476 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTGGACAGCGCCCTCTTCATTC -3'
(R):5'- GTCATACAGCAGGTCACCAAGCAG -3'

Sequencing Primer
(F):5'- TGAGTAACGCCATCCTTTATCAG -3'
(R):5'- CACCAAGCAGGAGGTCTTAAGTC -3'
Posted On2014-01-15