Incidental Mutation 'R1187:Soat1'
ID102222
Institutional Source Beutler Lab
Gene Symbol Soat1
Ensembl Gene ENSMUSG00000026600
Gene Namesterol O-acyltransferase 1
SynonymsACAT-1, 8430426K15Rik, Acact, hid
MMRRC Submission 039259-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R1187 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location156424525-156474331 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 156434175 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 421 (Y421F)
Ref Sequence ENSEMBL: ENSMUSP00000140721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051396] [ENSMUST00000189661]
Predicted Effect probably damaging
Transcript: ENSMUST00000051396
AA Change: Y421F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058344
Gene: ENSMUSG00000026600
AA Change: Y421F

DomainStartEndE-ValueType
low complexity region 39 52 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
Pfam:MBOAT 161 510 3.9e-71 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187987
Predicted Effect probably damaging
Transcript: ENSMUST00000189661
AA Change: Y421F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140721
Gene: ENSMUSG00000026600
AA Change: Y421F

DomainStartEndE-ValueType
low complexity region 39 52 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
Pfam:MBOAT 161 510 1.2e-58 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the acyltransferase family. It is located in the endoplasmic reticulum, and catalyzes the formation of fatty acid-cholesterol esters. This gene has been implicated in the formation of beta-amyloid and atherosclerotic plaques by controlling the equilibrium between free cholesterol and cytoplasmic cholesteryl esters. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mutants producing no protein or a truncated protein show depletion of cholesterol esters in adrenal cortex and peritoneal macrophages. Additionally, null mutants have reduced eye openings due to atrophy of meibomian glands or abnromal morphology and arrangement of medullary cells of all hair types. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,528,981 M4276I probably benign Het
Apol7b A T 15: 77,423,403 F297L possibly damaging Het
C330027C09Rik T A 16: 49,000,293 N132K probably damaging Het
Capsl C T 15: 9,457,721 R9W probably damaging Het
Catsperb T C 12: 101,625,732 V1107A probably benign Het
Clca1 T C 3: 145,009,743 I544M probably benign Het
Cma2 T C 14: 55,972,823 V55A probably benign Het
Col10a1 A T 10: 34,394,838 I269F probably benign Het
Col26a1 G A 5: 136,744,166 H385Y probably damaging Het
Ctdp1 A G 18: 80,449,487 Y598H probably damaging Het
Dnajc1 A G 2: 18,284,709 S296P probably benign Het
Dvl2 A T 11: 70,006,136 T250S probably benign Het
Etv1 A G 12: 38,865,564 Y410C probably damaging Het
Gm38394 G A 1: 133,659,203 T132I probably damaging Het
Krcc1 A T 6: 71,284,628 K215* probably null Het
Lrr1 A T 12: 69,175,022 T313S probably benign Het
Lrrc7 T A 3: 158,160,402 E1234V probably damaging Het
Mepe G A 5: 104,338,248 R418H probably damaging Het
Myrfl G A 10: 116,831,542 T331I probably damaging Het
Nbeal1 T C 1: 60,194,528 W26R probably damaging Het
Nsrp1 G A 11: 77,046,027 P448S probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfml2a A G 2: 38,959,813 N514D probably damaging Het
Olfr1390 T G 11: 49,340,590 D19E probably damaging Het
Olfr167 T C 16: 19,515,046 T197A probably benign Het
Pcdhb1 C T 18: 37,265,544 R183C probably damaging Het
Phf14 T G 6: 11,941,496 C41G probably damaging Het
Pkhd1l1 T C 15: 44,498,051 V499A possibly damaging Het
Plcb4 A G 2: 135,968,394 I638V probably benign Het
Ppp4c T A 7: 126,786,200 I296F probably benign Het
Prkdc T C 16: 15,759,746 V2388A probably damaging Het
Rgl1 T C 1: 152,544,433 D353G probably benign Het
Rnf19b T G 4: 129,075,567 probably null Het
Ryr3 C T 2: 112,958,176 D190N probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sema3e G A 5: 14,232,084 M411I probably damaging Het
Sgsh A T 11: 119,346,578 Y403* probably null Het
Sh2d7 T A 9: 54,541,187 L164Q probably benign Het
Slfn8 A T 11: 83,003,488 V775E probably damaging Het
Smgc G A 15: 91,860,600 G287S probably damaging Het
Sri T C 5: 8,059,416 Y52H probably damaging Het
Stat4 C A 1: 52,076,677 Q259K probably damaging Het
Trpm5 A G 7: 143,074,469 L1023P probably damaging Het
Ush1c T A 7: 46,208,914 N650I probably benign Het
Vmn2r8 G T 5: 108,803,219 S120* probably null Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp629 A G 7: 127,610,229 S803P probably benign Het
Zfp629 T C 7: 127,611,887 K250R probably damaging Het
Zfp758 T A 17: 22,375,190 I187N probably benign Het
Zfp85 T A 13: 67,749,716 K79I probably damaging Het
Other mutations in Soat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Soat1 APN 1 156466730 missense probably benign 0.37
IGL00840:Soat1 APN 1 156434196 missense probably damaging 1.00
IGL00980:Soat1 APN 1 156441341 missense probably benign 0.00
IGL02032:Soat1 APN 1 156440575 missense probably benign 0.00
IGL02177:Soat1 APN 1 156440503 splice site probably benign
IGL02718:Soat1 APN 1 156441429 missense probably benign 0.02
IGL02756:Soat1 APN 1 156446575 missense probably benign
IGL02884:Soat1 APN 1 156441356 missense possibly damaging 0.88
R0309:Soat1 UTSW 1 156442453 missense probably damaging 1.00
R0315:Soat1 UTSW 1 156440513 nonsense probably null
R0492:Soat1 UTSW 1 156441354 missense probably benign 0.00
R0519:Soat1 UTSW 1 156441246 missense probably damaging 1.00
R1184:Soat1 UTSW 1 156442374 splice site probably null
R1310:Soat1 UTSW 1 156441332 missense possibly damaging 0.92
R1378:Soat1 UTSW 1 156466782 utr 5 prime probably benign
R1547:Soat1 UTSW 1 156439761 missense probably damaging 0.98
R1690:Soat1 UTSW 1 156444574 missense probably benign
R1771:Soat1 UTSW 1 156442421 missense probably benign
R1776:Soat1 UTSW 1 156442421 missense probably benign
R2264:Soat1 UTSW 1 156437697 splice site probably benign
R2483:Soat1 UTSW 1 156431099 missense probably damaging 1.00
R4838:Soat1 UTSW 1 156432937 missense probably benign 0.05
R4863:Soat1 UTSW 1 156432328 missense probably damaging 0.98
R5366:Soat1 UTSW 1 156444611 missense probably benign 0.00
R5828:Soat1 UTSW 1 156437748 missense probably benign 0.01
R6381:Soat1 UTSW 1 156435803 missense probably damaging 0.99
R6583:Soat1 UTSW 1 156466492 intron probably null
R7085:Soat1 UTSW 1 156432331 missense not run
Predicted Primers PCR Primer
(F):5'- AGCATGGCTCACATAAACCTGTCTC -3'
(R):5'- TGTAGCCTCAGTGTGTGGACAAAC -3'

Sequencing Primer
(F):5'- gaaggaaagagggagggaag -3'
(R):5'- CTCAGTGTGTGGACAAACAGTTTATC -3'
Posted On2014-01-15