Incidental Mutation 'R1187:Pcdhb1'
ID102320
Institutional Source Beutler Lab
Gene Symbol Pcdhb1
Ensembl Gene ENSMUSG00000051663
Gene Nameprotocadherin beta 1
SynonymsPcdhbA
MMRRC Submission 039259-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R1187 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37264938-37267525 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 37265544 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 183 (R183C)
Ref Sequence ENSEMBL: ENSMUSP00000057519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052366] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably damaging
Transcript: ENSMUST00000052366
AA Change: R183C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057519
Gene: ENSMUSG00000051663
AA Change: R183C

DomainStartEndE-ValueType
CA 45 131 1.04e-1 SMART
CA 155 240 1.23e-19 SMART
CA 264 345 8.4e-27 SMART
CA 369 450 5.31e-15 SMART
CA 474 560 6.27e-26 SMART
CA 590 671 6.05e-10 SMART
Pfam:Cadherin_C_2 687 772 4.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G T 11: 9,528,981 M4276I probably benign Het
Apol7b A T 15: 77,423,403 F297L possibly damaging Het
C330027C09Rik T A 16: 49,000,293 N132K probably damaging Het
Capsl C T 15: 9,457,721 R9W probably damaging Het
Catsperb T C 12: 101,625,732 V1107A probably benign Het
Clca1 T C 3: 145,009,743 I544M probably benign Het
Cma2 T C 14: 55,972,823 V55A probably benign Het
Col10a1 A T 10: 34,394,838 I269F probably benign Het
Col26a1 G A 5: 136,744,166 H385Y probably damaging Het
Ctdp1 A G 18: 80,449,487 Y598H probably damaging Het
Dnajc1 A G 2: 18,284,709 S296P probably benign Het
Dvl2 A T 11: 70,006,136 T250S probably benign Het
Etv1 A G 12: 38,865,564 Y410C probably damaging Het
Gm38394 G A 1: 133,659,203 T132I probably damaging Het
Krcc1 A T 6: 71,284,628 K215* probably null Het
Lrr1 A T 12: 69,175,022 T313S probably benign Het
Lrrc7 T A 3: 158,160,402 E1234V probably damaging Het
Mepe G A 5: 104,338,248 R418H probably damaging Het
Myrfl G A 10: 116,831,542 T331I probably damaging Het
Nbeal1 T C 1: 60,194,528 W26R probably damaging Het
Nsrp1 G A 11: 77,046,027 P448S probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfml2a A G 2: 38,959,813 N514D probably damaging Het
Olfr1390 T G 11: 49,340,590 D19E probably damaging Het
Olfr167 T C 16: 19,515,046 T197A probably benign Het
Phf14 T G 6: 11,941,496 C41G probably damaging Het
Pkhd1l1 T C 15: 44,498,051 V499A possibly damaging Het
Plcb4 A G 2: 135,968,394 I638V probably benign Het
Ppp4c T A 7: 126,786,200 I296F probably benign Het
Prkdc T C 16: 15,759,746 V2388A probably damaging Het
Rgl1 T C 1: 152,544,433 D353G probably benign Het
Rnf19b T G 4: 129,075,567 probably null Het
Ryr3 C T 2: 112,958,176 D190N probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sema3e G A 5: 14,232,084 M411I probably damaging Het
Sgsh A T 11: 119,346,578 Y403* probably null Het
Sh2d7 T A 9: 54,541,187 L164Q probably benign Het
Slfn8 A T 11: 83,003,488 V775E probably damaging Het
Smgc G A 15: 91,860,600 G287S probably damaging Het
Soat1 T A 1: 156,434,175 Y421F probably damaging Het
Sri T C 5: 8,059,416 Y52H probably damaging Het
Stat4 C A 1: 52,076,677 Q259K probably damaging Het
Trpm5 A G 7: 143,074,469 L1023P probably damaging Het
Ush1c T A 7: 46,208,914 N650I probably benign Het
Vmn2r8 G T 5: 108,803,219 S120* probably null Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp629 A G 7: 127,610,229 S803P probably benign Het
Zfp629 T C 7: 127,611,887 K250R probably damaging Het
Zfp758 T A 17: 22,375,190 I187N probably benign Het
Zfp85 T A 13: 67,749,716 K79I probably damaging Het
Other mutations in Pcdhb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Pcdhb1 APN 18 37267342 missense probably benign 0.06
IGL01622:Pcdhb1 APN 18 37266313 missense possibly damaging 0.73
IGL01623:Pcdhb1 APN 18 37266313 missense possibly damaging 0.73
IGL01663:Pcdhb1 APN 18 37267133 missense possibly damaging 0.83
IGL01665:Pcdhb1 APN 18 37267397 missense probably benign 0.01
IGL01780:Pcdhb1 APN 18 37266522 missense probably damaging 1.00
IGL02121:Pcdhb1 APN 18 37265785 missense probably benign 0.06
IGL02468:Pcdhb1 APN 18 37266178 missense probably benign 0.21
IGL02602:Pcdhb1 APN 18 37266796 missense probably damaging 1.00
K3955:Pcdhb1 UTSW 18 37265973 missense probably damaging 1.00
R0242:Pcdhb1 UTSW 18 37266735 missense probably benign 0.17
R0242:Pcdhb1 UTSW 18 37266735 missense probably benign 0.17
R0329:Pcdhb1 UTSW 18 37267024 missense possibly damaging 0.59
R0627:Pcdhb1 UTSW 18 37265721 missense probably damaging 1.00
R0848:Pcdhb1 UTSW 18 37267422 missense probably benign 0.00
R1290:Pcdhb1 UTSW 18 37265230 missense possibly damaging 0.54
R1928:Pcdhb1 UTSW 18 37266180 nonsense probably null
R1957:Pcdhb1 UTSW 18 37265707 missense probably damaging 1.00
R2897:Pcdhb1 UTSW 18 37266463 missense probably damaging 1.00
R2898:Pcdhb1 UTSW 18 37266463 missense probably damaging 1.00
R3037:Pcdhb1 UTSW 18 37265113 missense probably damaging 1.00
R4193:Pcdhb1 UTSW 18 37267146 missense probably damaging 0.99
R4291:Pcdhb1 UTSW 18 37265417 missense probably damaging 1.00
R4308:Pcdhb1 UTSW 18 37266661 missense probably benign 0.00
R4332:Pcdhb1 UTSW 18 37265530 missense probably damaging 1.00
R4606:Pcdhb1 UTSW 18 37265528 nonsense probably null
R4637:Pcdhb1 UTSW 18 37265749 missense possibly damaging 0.95
R5159:Pcdhb1 UTSW 18 37266363 missense possibly damaging 0.89
R5207:Pcdhb1 UTSW 18 37266462 missense probably damaging 1.00
R5211:Pcdhb1 UTSW 18 37266651 missense probably benign 0.06
R5273:Pcdhb1 UTSW 18 37265713 missense probably benign 0.23
R5335:Pcdhb1 UTSW 18 37267255 missense probably benign 0.00
R5398:Pcdhb1 UTSW 18 37266154 missense probably damaging 1.00
R5452:Pcdhb1 UTSW 18 37265758 missense possibly damaging 0.94
R5837:Pcdhb1 UTSW 18 37265827 missense possibly damaging 0.57
R5882:Pcdhb1 UTSW 18 37267177 missense probably benign 0.05
R5947:Pcdhb1 UTSW 18 37266673 missense possibly damaging 0.74
R6109:Pcdhb1 UTSW 18 37265253 missense possibly damaging 0.69
R7052:Pcdhb1 UTSW 18 37266529 missense probably damaging 1.00
R7082:Pcdhb1 UTSW 18 37266991 missense probably damaging 0.99
R7137:Pcdhb1 UTSW 18 37267392 missense possibly damaging 0.69
R7229:Pcdhb1 UTSW 18 37266687 missense probably damaging 1.00
R7392:Pcdhb1 UTSW 18 37265118 missense possibly damaging 0.95
T0970:Pcdhb1 UTSW 18 37265973 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGCAAGACTGGAGATTTGTTCGTC -3'
(R):5'- ACCACCAAAGAGCCATTGTCGCTG -3'

Sequencing Primer
(F):5'- CGAGGCACTTTGTGGCAAATC -3'
(R):5'- GCTGTTCTCTGGCACCTGAG -3'
Posted On2014-01-15