Incidental Mutation 'R1188:Sun1'
ID102347
Institutional Source Beutler Lab
Gene Symbol Sun1
Ensembl Gene ENSMUSG00000036817
Gene NameSad1 and UNC84 domain containing 1
SynonymsUnc84a, 5730434D03Rik, 4632417G13Rik
MMRRC Submission 039260-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1188 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location139200637-139249840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 139238856 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 546 (R546C)
Ref Sequence ENSEMBL: ENSMUSP00000077756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058716] [ENSMUST00000078690] [ENSMUST00000110882] [ENSMUST00000110883] [ENSMUST00000110884]
Predicted Effect probably damaging
Transcript: ENSMUST00000058716
AA Change: R610C

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000056655
Gene: ENSMUSG00000036817
AA Change: R610C

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 334 450 2e-3 SMART
low complexity region 466 475 N/A INTRINSIC
coiled coil region 492 527 N/A INTRINSIC
SCOP:d1eq1a_ 572 689 3e-3 SMART
Pfam:Sad1_UNC 777 911 2.2e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000078690
AA Change: R546C

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000077756
Gene: ENSMUSG00000036817
AA Change: R546C

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 270 386 2e-3 SMART
low complexity region 402 411 N/A INTRINSIC
coiled coil region 428 463 N/A INTRINSIC
SCOP:d1eq1a_ 508 625 2e-3 SMART
Pfam:Sad1_UNC 713 847 1.9e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110882
AA Change: R454C

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106506
Gene: ENSMUSG00000036817
AA Change: R454C

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
low complexity region 263 271 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
coiled coil region 336 371 N/A INTRINSIC
SCOP:d1eq1a_ 416 533 4e-3 SMART
Pfam:Sad1_UNC 621 755 7.1e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110883
AA Change: R487C

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106507
Gene: ENSMUSG00000036817
AA Change: R487C

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 233 327 4e-3 SMART
low complexity region 343 352 N/A INTRINSIC
coiled coil region 369 404 N/A INTRINSIC
SCOP:d1eq1a_ 449 566 3e-3 SMART
Pfam:Sad1_UNC 654 788 1.7e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110884
AA Change: R573C

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106508
Gene: ENSMUSG00000036817
AA Change: R573C

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
Pfam:MRP 274 381 1.8e-8 PFAM
low complexity region 382 390 N/A INTRINSIC
low complexity region 429 438 N/A INTRINSIC
coiled coil region 455 490 N/A INTRINSIC
SCOP:d1eq1a_ 535 652 4e-3 SMART
Pfam:Sad1_UNC 740 874 2e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126108
Predicted Effect probably benign
Transcript: ENSMUST00000127310
SMART Domains Protein: ENSMUSP00000114514
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
PDB:4DXS|A 38 73 3e-6 PDB
Predicted Effect unknown
Transcript: ENSMUST00000128817
AA Change: R104C
SMART Domains Protein: ENSMUSP00000119587
Gene: ENSMUSG00000036817
AA Change: R104C

DomainStartEndE-ValueType
coiled coil region 58 126 N/A INTRINSIC
PDB:4DXS|A 207 258 1e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000135926
SMART Domains Protein: ENSMUSP00000114488
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
ZnF_C2H2 11 33 5.2e0 SMART
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 149 171 N/A INTRINSIC
low complexity region 202 211 N/A INTRINSIC
coiled coil region 227 255 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the unc-84 homolog family and encodes a nuclear nuclear envelope protein with an Unc84 (SUN) domain. The protein is involved in nuclear anchorage and migration. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit sterility due to arrested meiosis, hearing loss associated with outer hair cell degeneration, abnormal cerebellum development, ataxia, impaired motor coordination, and abnormal Purkinje cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik T C 5: 65,990,398 Y14C unknown Het
Afap1l2 T C 19: 56,925,069 K312E probably damaging Het
Amigo2 T A 15: 97,245,713 E276V probably benign Het
Asna1 A G 8: 85,019,793 I142T probably damaging Het
Atf2 A G 2: 73,845,537 F114L probably damaging Het
Avpr1a G T 10: 122,448,919 G39C possibly damaging Het
Ccpg1 A G 9: 73,012,506 R468G possibly damaging Het
Celf6 G T 9: 59,590,678 R130L probably benign Het
Dsp T C 13: 38,194,963 S1296P probably damaging Het
Fnip2 C T 3: 79,462,162 R1072H probably damaging Het
Fsip2 G T 2: 82,975,017 C560F possibly damaging Het
Gpr20 A C 15: 73,695,768 H257Q probably damaging Het
Gys2 T A 6: 142,455,183 H297L probably damaging Het
Habp2 G A 19: 56,311,722 S201N probably benign Het
Hars2 T C 18: 36,787,969 I198T probably damaging Het
Jag2 G A 12: 112,920,121 Q247* probably null Het
Jam2 A G 16: 84,806,867 T81A probably damaging Het
Mrps26 G A 2: 130,564,381 E145K probably damaging Het
Nup210l T C 3: 90,198,179 F1545L probably benign Het
Olfr961 A G 9: 39,647,476 Y250C probably damaging Het
Pikfyve T A 1: 65,246,959 V1074D possibly damaging Het
Prkag1 T A 15: 98,814,598 I118F probably damaging Het
R3hdm2 G A 10: 127,452,755 V91I probably benign Het
Rnf168 T C 16: 32,298,659 V346A probably benign Het
Slc17a7 T C 7: 45,169,887 V129A possibly damaging Het
Snai3 T A 8: 122,454,962 Q252L probably damaging Het
Snx17 T C 5: 31,195,822 V133A probably benign Het
Stt3a A G 9: 36,751,340 S59P probably damaging Het
Thsd4 T A 9: 60,394,406 Q202L probably benign Het
Tnrc6b A G 15: 80,879,229 T311A probably benign Het
Tshr T A 12: 91,502,168 D18E probably benign Het
Ttn A T 2: 76,789,429 L15965Q probably damaging Het
Wnk1 C A 6: 119,948,709 E1265* probably null Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Other mutations in Sun1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Sun1 APN 5 139234685 critical splice acceptor site probably null
IGL01364:Sun1 APN 5 139234741 missense probably damaging 1.00
IGL02142:Sun1 APN 5 139231163 missense possibly damaging 0.95
IGL02251:Sun1 APN 5 139241431 missense probably damaging 1.00
IGL02939:Sun1 APN 5 139235488 splice site probably benign
IGL03253:Sun1 APN 5 139223586 splice site probably benign
IGL03370:Sun1 APN 5 139231131 missense probably damaging 0.96
PIT4418001:Sun1 UTSW 5 139226588 missense probably damaging 0.97
R0124:Sun1 UTSW 5 139246679 unclassified probably benign
R0145:Sun1 UTSW 5 139241411 missense probably damaging 0.98
R0376:Sun1 UTSW 5 139226699 unclassified probably benign
R0512:Sun1 UTSW 5 139234847 splice site probably benign
R0729:Sun1 UTSW 5 139237864 unclassified probably benign
R0733:Sun1 UTSW 5 139231163 missense possibly damaging 0.63
R1724:Sun1 UTSW 5 139235725 missense probably benign
R1733:Sun1 UTSW 5 139230789 missense possibly damaging 0.82
R1913:Sun1 UTSW 5 139235732 critical splice donor site probably null
R2033:Sun1 UTSW 5 139225438 missense probably damaging 1.00
R2200:Sun1 UTSW 5 139231219 missense probably benign 0.11
R3084:Sun1 UTSW 5 139235601 missense probably benign 0.41
R3085:Sun1 UTSW 5 139235601 missense probably benign 0.41
R3771:Sun1 UTSW 5 139238820 unclassified probably benign
R3772:Sun1 UTSW 5 139238820 unclassified probably benign
R3804:Sun1 UTSW 5 139225362 nonsense probably null
R4300:Sun1 UTSW 5 139227594 unclassified probably benign
R4428:Sun1 UTSW 5 139234475 intron probably benign
R4993:Sun1 UTSW 5 139225333 missense possibly damaging 0.84
R5075:Sun1 UTSW 5 139226891 splice site probably null
R5363:Sun1 UTSW 5 139234743 missense probably damaging 1.00
R5826:Sun1 UTSW 5 139245416 missense probably damaging 1.00
R6753:Sun1 UTSW 5 139215259 splice site probably null
R7218:Sun1 UTSW 5 139226687 missense unknown
R7320:Sun1 UTSW 5 139248484 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAAAACAGTGTTCATCTCACAGC -3'
(R):5'- GGCAGCCACAATGAATCACTCTGAC -3'

Sequencing Primer
(F):5'- TGCAGATTCAGCCTCAAGG -3'
(R):5'- CACAGCCAGGTGAGCTTTTC -3'
Posted On2014-01-15