Incidental Mutation 'R1188:Ccpg1'
ID102371
Institutional Source Beutler Lab
Gene Symbol Ccpg1
Ensembl Gene ENSMUSG00000034563
Gene Namecell cycle progression 1
Synonyms1700030B06Rik, D9Ertd392e, 1810073J13Rik, 9430028F23Rik
MMRRC Submission 039260-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1188 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location72985429-73016340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73012506 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 468 (R468G)
Ref Sequence ENSEMBL: ENSMUSP00000122966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037977] [ENSMUST00000085350] [ENSMUST00000093819] [ENSMUST00000098566] [ENSMUST00000124008] [ENSMUST00000140675] [ENSMUST00000149692] [ENSMUST00000150826] [ENSMUST00000183746] [ENSMUST00000184035] [ENSMUST00000184389]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037977
AA Change: R468G

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000045669
Gene: ENSMUSG00000034563
AA Change: R468G

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 187 209 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
coiled coil region 296 450 N/A INTRINSIC
low complexity region 566 572 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085350
AA Change: R468G

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000082458
Gene: ENSMUSG00000034563
AA Change: R468G

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 187 209 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
coiled coil region 296 450 N/A INTRINSIC
low complexity region 566 572 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093819
Predicted Effect probably benign
Transcript: ENSMUST00000098566
SMART Domains Protein: ENSMUSP00000096165
Gene: ENSMUSG00000079469

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 51 438 4.7e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124008
SMART Domains Protein: ENSMUSP00000121059
Gene: ENSMUSG00000034563

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138466
Predicted Effect probably benign
Transcript: ENSMUST00000140675
AA Change: R468G

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116976
Gene: ENSMUSG00000034563
AA Change: R468G

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 187 209 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
coiled coil region 296 450 N/A INTRINSIC
low complexity region 566 572 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149692
SMART Domains Protein: ENSMUSP00000120629
Gene: ENSMUSG00000089865

DomainStartEndE-ValueType
Pfam:CS 6 77 2.1e-9 PFAM
coiled coil region 101 161 N/A INTRINSIC
Pfam:TPR_11 286 352 2e-14 PFAM
Pfam:TPR_1 322 352 5.6e-6 PFAM
Blast:TPR 364 386 1e-5 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000150826
AA Change: R468G

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122966
Gene: ENSMUSG00000034563
AA Change: R468G

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 187 209 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
coiled coil region 296 450 N/A INTRINSIC
low complexity region 566 572 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183746
SMART Domains Protein: ENSMUSP00000138885
Gene: ENSMUSG00000079469

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 51 438 3.9e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184035
SMART Domains Protein: ENSMUSP00000139269
Gene: ENSMUSG00000079469

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 51 438 3.9e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184389
SMART Domains Protein: ENSMUSP00000139076
Gene: ENSMUSG00000079469

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 51 438 3.9e-122 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik T C 5: 65,990,398 Y14C unknown Het
Afap1l2 T C 19: 56,925,069 K312E probably damaging Het
Amigo2 T A 15: 97,245,713 E276V probably benign Het
Asna1 A G 8: 85,019,793 I142T probably damaging Het
Atf2 A G 2: 73,845,537 F114L probably damaging Het
Avpr1a G T 10: 122,448,919 G39C possibly damaging Het
Celf6 G T 9: 59,590,678 R130L probably benign Het
Dsp T C 13: 38,194,963 S1296P probably damaging Het
Fnip2 C T 3: 79,462,162 R1072H probably damaging Het
Fsip2 G T 2: 82,975,017 C560F possibly damaging Het
Gpr20 A C 15: 73,695,768 H257Q probably damaging Het
Gys2 T A 6: 142,455,183 H297L probably damaging Het
Habp2 G A 19: 56,311,722 S201N probably benign Het
Hars2 T C 18: 36,787,969 I198T probably damaging Het
Jag2 G A 12: 112,920,121 Q247* probably null Het
Jam2 A G 16: 84,806,867 T81A probably damaging Het
Mrps26 G A 2: 130,564,381 E145K probably damaging Het
Nup210l T C 3: 90,198,179 F1545L probably benign Het
Olfr961 A G 9: 39,647,476 Y250C probably damaging Het
Pikfyve T A 1: 65,246,959 V1074D possibly damaging Het
Prkag1 T A 15: 98,814,598 I118F probably damaging Het
R3hdm2 G A 10: 127,452,755 V91I probably benign Het
Rnf168 T C 16: 32,298,659 V346A probably benign Het
Slc17a7 T C 7: 45,169,887 V129A possibly damaging Het
Snai3 T A 8: 122,454,962 Q252L probably damaging Het
Snx17 T C 5: 31,195,822 V133A probably benign Het
Stt3a A G 9: 36,751,340 S59P probably damaging Het
Sun1 C T 5: 139,238,856 R546C probably damaging Het
Thsd4 T A 9: 60,394,406 Q202L probably benign Het
Tnrc6b A G 15: 80,879,229 T311A probably benign Het
Tshr T A 12: 91,502,168 D18E probably benign Het
Ttn A T 2: 76,789,429 L15965Q probably damaging Het
Wnk1 C A 6: 119,948,709 E1265* probably null Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Other mutations in Ccpg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01665:Ccpg1 APN 9 73005877 missense probably damaging 1.00
IGL01710:Ccpg1 APN 9 72997441 utr 3 prime probably benign
IGL01818:Ccpg1 APN 9 72997453 missense probably damaging 1.00
K7894:Ccpg1 UTSW 9 73001877 critical splice donor site probably null
R0586:Ccpg1 UTSW 9 73001821 missense probably benign 0.00
R1503:Ccpg1 UTSW 9 72999478 missense probably benign 0.00
R1599:Ccpg1 UTSW 9 72999125 nonsense probably null
R2130:Ccpg1 UTSW 9 73013158 missense probably damaging 0.98
R2188:Ccpg1 UTSW 9 73013106 missense probably benign 0.00
R3052:Ccpg1 UTSW 9 73005868 missense probably damaging 1.00
R4155:Ccpg1 UTSW 9 73012167 missense probably benign 0.38
R4156:Ccpg1 UTSW 9 73012167 missense probably benign 0.38
R4157:Ccpg1 UTSW 9 73012167 missense probably benign 0.38
R4257:Ccpg1 UTSW 9 73012627 missense probably damaging 1.00
R4677:Ccpg1 UTSW 9 73015915 intron probably benign
R5081:Ccpg1 UTSW 9 72999078 missense possibly damaging 0.94
R5227:Ccpg1 UTSW 9 73012072 nonsense probably null
R5288:Ccpg1 UTSW 9 73013044 missense probably benign
R5385:Ccpg1 UTSW 9 73013044 missense probably benign
R5386:Ccpg1 UTSW 9 73013044 missense probably benign
R5412:Ccpg1 UTSW 9 73010306 missense probably damaging 1.00
R5754:Ccpg1 UTSW 9 73013244 missense possibly damaging 0.78
R6230:Ccpg1 UTSW 9 73012356 missense probably benign 0.00
R7269:Ccpg1 UTSW 9 73013327 missense probably benign 0.06
R7287:Ccpg1 UTSW 9 73015406 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GCACAAGCACGCAGTTAGTTAGGG -3'
(R):5'- AGTTGCCGCTTCTTTTGGAGCC -3'

Sequencing Primer
(F):5'- AGAACTTGAGCAGTTCATCCCTG -3'
(R):5'- GGAGCCCTGAATCTCTTGCTG -3'
Posted On2014-01-15