Incidental Mutation 'R1189:Ppara'
ID 102439
Institutional Source Beutler Lab
Gene Symbol Ppara
Ensembl Gene ENSMUSG00000022383
Gene Name peroxisome proliferator activated receptor alpha
Synonyms PPAR-alpha, Nr1c1, 4933429D07Rik, Ppar, PPARalpha
MMRRC Submission 039261-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1189 (G1)
Quality Score 176
Status Not validated
Chromosome 15
Chromosomal Location 85619184-85687020 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 85682365 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 354 (I354V)
Ref Sequence ENSEMBL: ENSMUSP00000105050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057979] [ENSMUST00000109422] [ENSMUST00000109423]
AlphaFold P23204
Predicted Effect probably benign
Transcript: ENSMUST00000057979
AA Change: I354V

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000059719
Gene: ENSMUSG00000022383
AA Change: I354V

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
low complexity region 73 89 N/A INTRINSIC
ZnF_C4 99 169 2.27e-34 SMART
HOLI 278 437 2.8e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109422
AA Change: I354V

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000105049
Gene: ENSMUSG00000022383
AA Change: I354V

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
low complexity region 73 89 N/A INTRINSIC
ZnF_C4 99 169 2.27e-34 SMART
HOLI 278 437 2.8e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109423
AA Change: I354V

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000105050
Gene: ENSMUSG00000022383
AA Change: I354V

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
low complexity region 73 89 N/A INTRINSIC
ZnF_C4 99 169 2.27e-34 SMART
HOLI 278 437 2.8e-25 SMART
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.2%
  • 10x: 92.5%
  • 20x: 81.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Peroxisome proliferators include hypolipidemic drugs, herbicides, leukotriene antagonists, and plasticizers; this term arises because they induce an increase in the size and number of peroxisomes. Peroxisomes are subcellular organelles found in plants and animals that contain enzymes for respiration and for cholesterol and lipid metabolism. The action of peroxisome proliferators is thought to be mediated via specific receptors, called PPARs, which belong to the steroid hormone receptor superfamily. PPARs affect the expression of target genes involved in cell proliferation, cell differentiation and in immune and inflammation responses. Three closely related subtypes (alpha, beta/delta, and gamma) have been identified. This gene encodes the subtype PPAR-alpha, which is a nuclear transcription factor. Multiple alternatively spliced transcript variants have been described for this gene, although the full-length nature of only two has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit loss of diurnal variation in hepatic fatty acid and cholesterol synthesis, increased hepatic lipid and gonadal adipose stores, impaired skin wound healing, and altered metabolic responses to starvation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930022D16Rik A G 11: 109,308,934 (GRCm39) H100R unknown Het
Abcc2 T A 19: 43,807,852 (GRCm39) V831D probably damaging Het
Akap11 A T 14: 78,750,787 (GRCm39) S533R probably benign Het
Aldh1a2 G T 9: 71,171,105 (GRCm39) A198S possibly damaging Het
Cbarp C A 10: 79,967,630 (GRCm39) R537L possibly damaging Het
Crybg1 T A 10: 43,874,790 (GRCm39) S773C probably damaging Het
Cyp3a13 G T 5: 137,909,892 (GRCm39) probably null Het
Gatad1 T A 5: 3,693,701 (GRCm39) D156V probably damaging Het
Ift172 T A 5: 31,443,174 (GRCm39) probably null Het
Lrrtm2 C T 18: 35,346,545 (GRCm39) W252* probably null Het
Mitf T C 6: 97,983,086 (GRCm39) C270R possibly damaging Het
Muc6 T A 7: 141,232,122 (GRCm39) S1002C probably damaging Het
Or4k2 A G 14: 50,424,539 (GRCm39) I45T probably damaging Het
Or5b113 A T 19: 13,342,543 (GRCm39) M184L probably benign Het
Pcdhb8 C T 18: 37,489,620 (GRCm39) Q92* probably null Het
Plekhm1 A G 11: 103,277,888 (GRCm39) S403P probably benign Het
Psmd2 T C 16: 20,480,644 (GRCm39) M761T probably benign Het
Xirp2 T A 2: 67,343,805 (GRCm39) N2015K probably damaging Het
Zbtb39 C G 10: 127,578,175 (GRCm39) Q250E probably benign Het
Other mutations in Ppara
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Ppara APN 15 85,685,268 (GRCm39) missense probably benign 0.00
IGL00754:Ppara APN 15 85,661,843 (GRCm39) missense probably damaging 0.99
IGL01409:Ppara APN 15 85,661,844 (GRCm39) missense probably damaging 0.98
IGL02080:Ppara APN 15 85,673,220 (GRCm39) missense possibly damaging 0.74
IGL02442:Ppara APN 15 85,685,344 (GRCm39) missense probably benign 0.19
IGL02810:Ppara APN 15 85,661,878 (GRCm39) missense probably damaging 0.99
IGL02852:Ppara APN 15 85,682,079 (GRCm39) missense probably benign 0.00
R0333:Ppara UTSW 15 85,675,161 (GRCm39) missense probably damaging 1.00
R0551:Ppara UTSW 15 85,671,306 (GRCm39) splice site probably benign
R0883:Ppara UTSW 15 85,682,372 (GRCm39) missense probably damaging 1.00
R1125:Ppara UTSW 15 85,673,256 (GRCm39) missense possibly damaging 0.71
R1233:Ppara UTSW 15 85,682,222 (GRCm39) missense probably damaging 1.00
R1582:Ppara UTSW 15 85,682,429 (GRCm39) missense possibly damaging 0.69
R1755:Ppara UTSW 15 85,682,180 (GRCm39) missense probably benign 0.14
R1913:Ppara UTSW 15 85,685,300 (GRCm39) missense probably damaging 1.00
R2163:Ppara UTSW 15 85,685,247 (GRCm39) missense probably benign 0.04
R4570:Ppara UTSW 15 85,671,398 (GRCm39) missense probably benign 0.02
R4980:Ppara UTSW 15 85,671,434 (GRCm39) missense probably damaging 0.99
R5117:Ppara UTSW 15 85,661,962 (GRCm39) missense probably benign 0.00
R5749:Ppara UTSW 15 85,673,229 (GRCm39) missense probably benign 0.35
R6199:Ppara UTSW 15 85,671,434 (GRCm39) missense probably damaging 0.99
R6221:Ppara UTSW 15 85,661,881 (GRCm39) missense probably benign 0.02
R6624:Ppara UTSW 15 85,675,237 (GRCm39) missense probably benign 0.24
R7382:Ppara UTSW 15 85,671,429 (GRCm39) missense probably damaging 1.00
R7534:Ppara UTSW 15 85,661,927 (GRCm39) missense probably benign
R7629:Ppara UTSW 15 85,682,392 (GRCm39) missense probably damaging 0.98
R8171:Ppara UTSW 15 85,682,077 (GRCm39) missense probably benign
R8848:Ppara UTSW 15 85,673,188 (GRCm39) missense possibly damaging 0.93
R9378:Ppara UTSW 15 85,661,837 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AAGAGGCAGAGGTCCGATTCTTCC -3'
(R):5'- TGGCACCATATTGACAACCACTGAG -3'

Sequencing Primer
(F):5'- ATTTGCCAAGGCTATCCCAGG -3'
(R):5'- CCACTGAGTTCCTACAGAAGG -3'
Posted On 2014-01-15