Incidental Mutation 'R1148:Arhgef16'
ID102515
Institutional Source Beutler Lab
Gene Symbol Arhgef16
Ensembl Gene ENSMUSG00000029032
Gene NameRho guanine nucleotide exchange factor (GEF) 16
SynonymsNeuroblastoma
MMRRC Submission 039221-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1148 (G1)
Quality Score150
Status Validated
Chromosome4
Chromosomal Location154278486-154301676 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 154280889 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 590 (N590D)
Ref Sequence ENSEMBL: ENSMUSP00000126296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030898] [ENSMUST00000169623]
Predicted Effect probably benign
Transcript: ENSMUST00000030898
AA Change: N590D

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000030898
Gene: ENSMUSG00000029032
AA Change: N590D

DomainStartEndE-ValueType
low complexity region 51 72 N/A INTRINSIC
RhoGEF 292 471 5.9e-52 SMART
PH 506 626 6.46e-8 SMART
SH3 636 692 2.31e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143141
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144145
Predicted Effect probably benign
Transcript: ENSMUST00000169623
AA Change: N590D

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000126296
Gene: ENSMUSG00000029032
AA Change: N590D

DomainStartEndE-ValueType
low complexity region 51 72 N/A INTRINSIC
RhoGEF 292 471 5.9e-52 SMART
PH 506 626 6.46e-8 SMART
SH3 636 692 2.31e-12 SMART
Meta Mutation Damage Score 0.0972 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 97.8%
  • 10x: 90.3%
  • 20x: 69.2%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Although the specific function of this protein is not known yet, it is thought to be involved in protein-protein and protein-lipid interactions. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,876,718 S14P probably damaging Het
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
Alg10b T C 15: 90,227,865 F304S possibly damaging Het
Ank3 C T 10: 69,882,539 S540F probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Cilp T A 9: 65,280,316 L1231Q possibly damaging Het
Cyp4x1 A G 4: 115,126,555 probably benign Het
Disp2 G A 2: 118,806,418 probably null Het
Dnah5 T C 15: 28,421,690 L3896P probably damaging Het
Dpp8 T C 9: 65,053,832 probably null Het
Esp4 A C 17: 40,602,371 N43T probably benign Het
Fat3 T C 9: 15,996,774 D2644G probably damaging Het
Fgd5 A G 6: 91,987,631 K124E probably benign Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Hexdc A G 11: 121,221,267 I438V probably benign Het
Lonp2 A G 8: 86,636,540 E262G probably benign Het
Ly6h G T 15: 75,565,172 S118R unknown Het
Mapk12 T C 15: 89,134,623 Y203C probably damaging Het
Mapk15 A G 15: 75,998,155 T375A probably benign Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Nsd3 A G 8: 25,713,380 D1307G probably benign Het
Olfr1009 C A 2: 85,722,276 Y290* probably null Het
Osbpl11 T C 16: 33,227,212 F515S probably damaging Het
Pcdh15 T C 10: 74,170,560 V90A probably damaging Het
Ptpn4 T C 1: 119,684,540 D41G probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Sez6l2 C A 7: 126,961,812 P483Q probably damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Sgo2b A G 8: 63,926,855 L981P probably damaging Het
Sh3d19 A G 3: 86,107,327 D475G possibly damaging Het
Shprh T C 10: 11,213,482 S1655P possibly damaging Het
Slc25a12 G A 2: 71,312,568 probably benign Het
Strc A G 2: 121,372,077 probably benign Het
Ttc22 G A 4: 106,623,031 V161M probably damaging Het
Unc79 T C 12: 103,112,667 L1504P probably damaging Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Other mutations in Arhgef16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Arhgef16 APN 4 154280244 missense probably benign 0.01
IGL02422:Arhgef16 APN 4 154287065 nonsense probably null
IGL02801:Arhgef16 APN 4 154291507 missense probably damaging 0.99
IGL02928:Arhgef16 APN 4 154282893 missense probably benign 0.00
R0518:Arhgef16 UTSW 4 154291034 missense probably damaging 0.99
R1148:Arhgef16 UTSW 4 154280889 missense probably benign 0.05
R1576:Arhgef16 UTSW 4 154291312 missense probably damaging 1.00
R1778:Arhgef16 UTSW 4 154287986 missense probably benign 0.17
R1853:Arhgef16 UTSW 4 154291106 missense probably benign 0.14
R1912:Arhgef16 UTSW 4 154280323 splice site probably null
R2269:Arhgef16 UTSW 4 154285033 missense probably damaging 0.98
R4437:Arhgef16 UTSW 4 154279696 critical splice donor site probably null
R4690:Arhgef16 UTSW 4 154287963 splice site probably null
R5174:Arhgef16 UTSW 4 154282047 missense probably damaging 1.00
R5566:Arhgef16 UTSW 4 154285648 missense probably benign 0.01
R6348:Arhgef16 UTSW 4 154287083 missense probably benign 0.18
R7264:Arhgef16 UTSW 4 154280930 missense probably damaging 1.00
R7469:Arhgef16 UTSW 4 154291306 missense probably damaging 1.00
Predicted Primers
Posted On2014-01-15