Incidental Mutation 'R1148:Lonp2'
ID102524
Institutional Source Beutler Lab
Gene Symbol Lonp2
Ensembl Gene ENSMUSG00000047866
Gene Namelon peptidase 2, peroxisomal
Synonyms1300002A08Rik
MMRRC Submission 039221-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock #R1148 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location86624043-86723873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86636540 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 262 (E262G)
Ref Sequence ENSEMBL: ENSMUSP00000118737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034141] [ENSMUST00000122188] [ENSMUST00000155433]
Predicted Effect probably benign
Transcript: ENSMUST00000034141
AA Change: E262G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034141
Gene: ENSMUSG00000047866
AA Change: E262G

DomainStartEndE-ValueType
Pfam:LON_substr_bdg 12 220 1e-24 PFAM
low complexity region 243 255 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
AAA 367 512 1.59e-10 SMART
low complexity region 538 545 N/A INTRINSIC
Pfam:Lon_C 628 837 1.6e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122188
SMART Domains Protein: ENSMUSP00000113834
Gene: ENSMUSG00000047866

DomainStartEndE-ValueType
Pfam:LON 12 224 9e-17 PFAM
AAA 225 370 1.59e-10 SMART
low complexity region 396 403 N/A INTRINSIC
Pfam:Lon_C 486 695 1.5e-83 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124911
Predicted Effect probably benign
Transcript: ENSMUST00000155433
AA Change: E262G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000118737
Gene: ENSMUSG00000047866
AA Change: E262G

DomainStartEndE-ValueType
Pfam:LON 12 220 3.3e-26 PFAM
low complexity region 243 255 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
AAA 367 512 1.59e-10 SMART
low complexity region 538 545 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155501
Meta Mutation Damage Score 0.0528 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 97.8%
  • 10x: 90.3%
  • 20x: 69.2%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In human, peroxisomes function primarily to catalyze fatty acid beta-oxidation and, as a by-product, produce hydrogen peroxide and superoxide. The protein encoded by this gene is an ATP-dependent protease that likely plays a role in maintaining overall peroxisome homeostasis as well as proteolytically degrading peroxisomal proteins damaged by oxidation. The protein has an N-terminal Lon N substrate recognition domain, an ATPase domain, a proteolytic domain, and, in some isoforms, a C-terminal peroxisome targeting sequence. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,876,718 S14P probably damaging Het
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
Alg10b T C 15: 90,227,865 F304S possibly damaging Het
Ank3 C T 10: 69,882,539 S540F probably damaging Het
Arhgef16 T C 4: 154,280,889 N590D probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Cilp T A 9: 65,280,316 L1231Q possibly damaging Het
Cyp4x1 A G 4: 115,126,555 probably benign Het
Disp2 G A 2: 118,806,418 probably null Het
Dnah5 T C 15: 28,421,690 L3896P probably damaging Het
Dpp8 T C 9: 65,053,832 probably null Het
Esp4 A C 17: 40,602,371 N43T probably benign Het
Fat3 T C 9: 15,996,774 D2644G probably damaging Het
Fgd5 A G 6: 91,987,631 K124E probably benign Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Hexdc A G 11: 121,221,267 I438V probably benign Het
Ly6h G T 15: 75,565,172 S118R unknown Het
Mapk12 T C 15: 89,134,623 Y203C probably damaging Het
Mapk15 A G 15: 75,998,155 T375A probably benign Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Nsd3 A G 8: 25,713,380 D1307G probably benign Het
Olfr1009 C A 2: 85,722,276 Y290* probably null Het
Osbpl11 T C 16: 33,227,212 F515S probably damaging Het
Pcdh15 T C 10: 74,170,560 V90A probably damaging Het
Ptpn4 T C 1: 119,684,540 D41G probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Sez6l2 C A 7: 126,961,812 P483Q probably damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Sgo2b A G 8: 63,926,855 L981P probably damaging Het
Sh3d19 A G 3: 86,107,327 D475G possibly damaging Het
Shprh T C 10: 11,213,482 S1655P possibly damaging Het
Slc25a12 G A 2: 71,312,568 probably benign Het
Strc A G 2: 121,372,077 probably benign Het
Ttc22 G A 4: 106,623,031 V161M probably damaging Het
Unc79 T C 12: 103,112,667 L1504P probably damaging Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Other mutations in Lonp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Lonp2 APN 8 86633972 missense probably damaging 1.00
IGL00990:Lonp2 APN 8 86641533 splice site probably benign
IGL01654:Lonp2 APN 8 86714086 missense probably damaging 1.00
IGL02021:Lonp2 APN 8 86708971 missense probably benign 0.00
IGL02165:Lonp2 APN 8 86709026 missense probably damaging 1.00
IGL02309:Lonp2 APN 8 86634863 missense probably damaging 1.00
IGL02355:Lonp2 APN 8 86624246 missense probably benign 0.17
IGL02362:Lonp2 APN 8 86624246 missense probably benign 0.17
IGL02365:Lonp2 APN 8 86716365 missense possibly damaging 0.69
IGL02374:Lonp2 APN 8 86709045 missense probably damaging 0.97
IGL02440:Lonp2 APN 8 86624185 start codon destroyed probably null 0.98
R0083:Lonp2 UTSW 8 86716355 missense probably benign 0.13
R0108:Lonp2 UTSW 8 86716355 missense probably benign 0.13
R0108:Lonp2 UTSW 8 86716355 missense probably benign 0.13
R0129:Lonp2 UTSW 8 86634890 missense probably damaging 0.99
R0302:Lonp2 UTSW 8 86637991 missense possibly damaging 0.94
R0433:Lonp2 UTSW 8 86633954 missense probably damaging 1.00
R1148:Lonp2 UTSW 8 86636540 missense probably benign 0.00
R1413:Lonp2 UTSW 8 86641584 missense probably damaging 1.00
R1589:Lonp2 UTSW 8 86673072 splice site probably benign
R1635:Lonp2 UTSW 8 86713450 missense possibly damaging 0.78
R1654:Lonp2 UTSW 8 86631450 missense probably damaging 0.99
R2033:Lonp2 UTSW 8 86708942 missense possibly damaging 0.77
R2062:Lonp2 UTSW 8 86665775 missense probably damaging 0.99
R2065:Lonp2 UTSW 8 86665775 missense probably damaging 0.99
R2066:Lonp2 UTSW 8 86665775 missense probably damaging 0.99
R2068:Lonp2 UTSW 8 86665775 missense probably damaging 0.99
R4321:Lonp2 UTSW 8 86665728 missense probably damaging 1.00
R4713:Lonp2 UTSW 8 86713315 missense probably damaging 0.98
R4750:Lonp2 UTSW 8 86631502 missense probably benign 0.09
R5790:Lonp2 UTSW 8 86631490 missense probably benign 0.24
R5854:Lonp2 UTSW 8 86673071 critical splice donor site probably null
R5884:Lonp2 UTSW 8 86641626 missense probably damaging 1.00
R6025:Lonp2 UTSW 8 86713373 missense probably damaging 1.00
R6236:Lonp2 UTSW 8 86636587 nonsense probably null
R6481:Lonp2 UTSW 8 86634908 missense possibly damaging 0.69
R6534:Lonp2 UTSW 8 86716458 missense probably benign 0.00
R6805:Lonp2 UTSW 8 86709096 missense probably benign
R6983:Lonp2 UTSW 8 86624248 missense probably damaging 1.00
Predicted Primers
Posted On2014-01-15