Incidental Mutation 'R1148:2810021J22Rik'
ID102535
Institutional Source Beutler Lab
Gene Symbol 2810021J22Rik
Ensembl Gene ENSMUSG00000020491
Gene NameRIKEN cDNA 2810021J22 gene
Synonyms
MMRRC Submission 039221-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1148 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58867216-58883288 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58876718 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 14 (S14P)
Ref Sequence ENSEMBL: ENSMUSP00000120692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073924] [ENSMUST00000132570]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073924
AA Change: S14P

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073579
Gene: ENSMUSG00000020491
AA Change: S14P

DomainStartEndE-ValueType
KRAB 8 68 2.38e-30 SMART
ZnF_C2H2 242 264 1.68e1 SMART
ZnF_C2H2 370 392 1.56e-2 SMART
ZnF_C2H2 398 420 1.03e-2 SMART
ZnF_C2H2 426 448 1.38e-3 SMART
ZnF_C2H2 454 476 3.16e-3 SMART
ZnF_C2H2 482 504 1.6e-4 SMART
ZnF_C2H2 510 532 7.78e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000132570
AA Change: S14P

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120692
Gene: ENSMUSG00000020491
AA Change: S14P

DomainStartEndE-ValueType
KRAB 8 64 2.25e-17 SMART
Meta Mutation Damage Score 0.0212 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 97.8%
  • 10x: 90.3%
  • 20x: 69.2%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
Alg10b T C 15: 90,227,865 F304S possibly damaging Het
Ank3 C T 10: 69,882,539 S540F probably damaging Het
Arhgef16 T C 4: 154,280,889 N590D probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Cilp T A 9: 65,280,316 L1231Q possibly damaging Het
Cyp4x1 A G 4: 115,126,555 probably benign Het
Disp2 G A 2: 118,806,418 probably null Het
Dnah5 T C 15: 28,421,690 L3896P probably damaging Het
Dpp8 T C 9: 65,053,832 probably null Het
Esp4 A C 17: 40,602,371 N43T probably benign Het
Fat3 T C 9: 15,996,774 D2644G probably damaging Het
Fgd5 A G 6: 91,987,631 K124E probably benign Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Hexdc A G 11: 121,221,267 I438V probably benign Het
Lonp2 A G 8: 86,636,540 E262G probably benign Het
Ly6h G T 15: 75,565,172 S118R unknown Het
Mapk12 T C 15: 89,134,623 Y203C probably damaging Het
Mapk15 A G 15: 75,998,155 T375A probably benign Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Nsd3 A G 8: 25,713,380 D1307G probably benign Het
Olfr1009 C A 2: 85,722,276 Y290* probably null Het
Osbpl11 T C 16: 33,227,212 F515S probably damaging Het
Pcdh15 T C 10: 74,170,560 V90A probably damaging Het
Ptpn4 T C 1: 119,684,540 D41G probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Sez6l2 C A 7: 126,961,812 P483Q probably damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Sgo2b A G 8: 63,926,855 L981P probably damaging Het
Sh3d19 A G 3: 86,107,327 D475G possibly damaging Het
Shprh T C 10: 11,213,482 S1655P possibly damaging Het
Slc25a12 G A 2: 71,312,568 probably benign Het
Strc A G 2: 121,372,077 probably benign Het
Ttc22 G A 4: 106,623,031 V161M probably damaging Het
Unc79 T C 12: 103,112,667 L1504P probably damaging Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Other mutations in 2810021J22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:2810021J22Rik APN 11 58880612 nonsense probably null
IGL01784:2810021J22Rik APN 11 58880619 missense possibly damaging 0.89
IGL02287:2810021J22Rik APN 11 58880592 missense probably benign 0.00
IGL03281:2810021J22Rik APN 11 58880775 missense probably benign 0.01
H8562:2810021J22Rik UTSW 11 58880891 missense probably damaging 1.00
R0480:2810021J22Rik UTSW 11 58880186 missense probably damaging 0.99
R1148:2810021J22Rik UTSW 11 58876718 missense probably damaging 0.97
R1493:2810021J22Rik UTSW 11 58876718 missense probably damaging 0.97
R1565:2810021J22Rik UTSW 11 58880501 missense probably benign 0.00
R1676:2810021J22Rik UTSW 11 58880993 missense possibly damaging 0.70
R2070:2810021J22Rik UTSW 11 58876769 missense probably damaging 0.98
R2071:2810021J22Rik UTSW 11 58876769 missense probably damaging 0.98
R4402:2810021J22Rik UTSW 11 58880194 missense probably benign 0.01
R4541:2810021J22Rik UTSW 11 58878850 missense probably benign 0.16
R4685:2810021J22Rik UTSW 11 58880924 missense probably damaging 0.97
R4765:2810021J22Rik UTSW 11 58881161 missense probably benign 0.09
R4968:2810021J22Rik UTSW 11 58878790 nonsense probably null
R5282:2810021J22Rik UTSW 11 58880340 missense possibly damaging 0.84
R5519:2810021J22Rik UTSW 11 58880097 missense probably benign
R6083:2810021J22Rik UTSW 11 58878851 missense possibly damaging 0.73
R6134:2810021J22Rik UTSW 11 58876793 missense probably damaging 1.00
R6334:2810021J22Rik UTSW 11 58880114 missense probably benign
R7108:2810021J22Rik UTSW 11 58880924 missense probably damaging 0.97
Predicted Primers
Posted On2014-01-15