Incidental Mutation 'R1148:Hexdc'
ID102536
Institutional Source Beutler Lab
Gene Symbol Hexdc
Ensembl Gene ENSMUSG00000039307
Gene Namehexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing
Synonyms
MMRRC Submission 039221-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R1148 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location121204433-121222655 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121221267 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 438 (I438V)
Ref Sequence ENSEMBL: ENSMUSP00000048479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038709] [ENSMUST00000038831] [ENSMUST00000106115] [ENSMUST00000106117] [ENSMUST00000137299] [ENSMUST00000147490] [ENSMUST00000169393]
Predicted Effect probably benign
Transcript: ENSMUST00000038709
SMART Domains Protein: ENSMUSP00000042277
Gene: ENSMUSG00000039294

DomainStartEndE-ValueType
Pfam:DUF4564 1 187 1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038831
AA Change: I438V

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000048479
Gene: ENSMUSG00000039307
AA Change: I438V

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 30 223 2.9e-12 PFAM
low complexity region 528 538 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106115
SMART Domains Protein: ENSMUSP00000101721
Gene: ENSMUSG00000039294

DomainStartEndE-ValueType
Pfam:DUF4564 2 184 3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106117
AA Change: I365V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101723
Gene: ENSMUSG00000039307
AA Change: I365V

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 31 229 1.7e-18 PFAM
low complexity region 455 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124761
SMART Domains Protein: ENSMUSP00000116406
Gene: ENSMUSG00000039307

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 20 194 6.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133535
Predicted Effect probably benign
Transcript: ENSMUST00000137299
SMART Domains Protein: ENSMUSP00000120541
Gene: ENSMUSG00000039294

DomainStartEndE-ValueType
Pfam:DUF4564 1 150 9.9e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147490
SMART Domains Protein: ENSMUSP00000117829
Gene: ENSMUSG00000039294

DomainStartEndE-ValueType
Pfam:DUF4564 1 132 7.2e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149351
Predicted Effect unknown
Transcript: ENSMUST00000151495
AA Change: I434V
SMART Domains Protein: ENSMUSP00000123073
Gene: ENSMUSG00000039307
AA Change: I434V

DomainStartEndE-ValueType
Pfam:Glyco_hydro_20 27 220 3.1e-12 PFAM
low complexity region 525 535 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169393
SMART Domains Protein: ENSMUSP00000127260
Gene: ENSMUSG00000039294

DomainStartEndE-ValueType
Pfam:DUF4564 1 51 6.9e-20 PFAM
low complexity region 67 78 N/A INTRINSIC
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 97.8%
  • 10x: 90.3%
  • 20x: 69.2%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,876,718 S14P probably damaging Het
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
Alg10b T C 15: 90,227,865 F304S possibly damaging Het
Ank3 C T 10: 69,882,539 S540F probably damaging Het
Arhgef16 T C 4: 154,280,889 N590D probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Cilp T A 9: 65,280,316 L1231Q possibly damaging Het
Cyp4x1 A G 4: 115,126,555 probably benign Het
Disp2 G A 2: 118,806,418 probably null Het
Dnah5 T C 15: 28,421,690 L3896P probably damaging Het
Dpp8 T C 9: 65,053,832 probably null Het
Esp4 A C 17: 40,602,371 N43T probably benign Het
Fat3 T C 9: 15,996,774 D2644G probably damaging Het
Fgd5 A G 6: 91,987,631 K124E probably benign Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Lonp2 A G 8: 86,636,540 E262G probably benign Het
Ly6h G T 15: 75,565,172 S118R unknown Het
Mapk12 T C 15: 89,134,623 Y203C probably damaging Het
Mapk15 A G 15: 75,998,155 T375A probably benign Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Nsd3 A G 8: 25,713,380 D1307G probably benign Het
Olfr1009 C A 2: 85,722,276 Y290* probably null Het
Osbpl11 T C 16: 33,227,212 F515S probably damaging Het
Pcdh15 T C 10: 74,170,560 V90A probably damaging Het
Ptpn4 T C 1: 119,684,540 D41G probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Sez6l2 C A 7: 126,961,812 P483Q probably damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Sgo2b A G 8: 63,926,855 L981P probably damaging Het
Sh3d19 A G 3: 86,107,327 D475G possibly damaging Het
Shprh T C 10: 11,213,482 S1655P possibly damaging Het
Slc25a12 G A 2: 71,312,568 probably benign Het
Strc A G 2: 121,372,077 probably benign Het
Ttc22 G A 4: 106,623,031 V161M probably damaging Het
Unc79 T C 12: 103,112,667 L1504P probably damaging Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Other mutations in Hexdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Hexdc APN 11 121221160 missense probably benign 0.35
IGL01981:Hexdc APN 11 121216993 missense possibly damaging 0.93
R0360:Hexdc UTSW 11 121212143 missense probably benign 0.18
R0364:Hexdc UTSW 11 121212143 missense probably benign 0.18
R0376:Hexdc UTSW 11 121218165 splice site probably benign
R1148:Hexdc UTSW 11 121221267 missense probably benign 0.09
R1493:Hexdc UTSW 11 121221267 missense probably benign 0.09
R1883:Hexdc UTSW 11 121207698 missense probably benign 0.00
R4021:Hexdc UTSW 11 121218161 critical splice donor site probably null
R4163:Hexdc UTSW 11 121221149 missense probably benign 0.01
R4939:Hexdc UTSW 11 121207716 missense probably benign
R5308:Hexdc UTSW 11 121222269 missense probably damaging 1.00
R5716:Hexdc UTSW 11 121221562 missense probably benign 0.03
R6127:Hexdc UTSW 11 121216999 missense possibly damaging 0.89
R6154:Hexdc UTSW 11 121221271 missense probably benign 0.02
R6921:Hexdc UTSW 11 121222281 missense probably damaging 0.98
R6928:Hexdc UTSW 11 121212054 missense possibly damaging 0.82
R6939:Hexdc UTSW 11 121222338 missense probably benign 0.09
R7125:Hexdc UTSW 11 121204670 unclassified probably benign
R7522:Hexdc UTSW 11 121218097 missense possibly damaging 0.61
Predicted Primers
Posted On2014-01-15