Incidental Mutation 'R1148:Mapk12'
ID102540
Institutional Source Beutler Lab
Gene Symbol Mapk12
Ensembl Gene ENSMUSG00000022610
Gene Namemitogen-activated protein kinase 12
SynonymsSapk3, P38gamma, Erk6, Prkm12
MMRRC Submission 039221-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1148 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location89130584-89140703 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89134623 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 203 (Y203C)
Ref Sequence ENSEMBL: ENSMUSP00000086207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088827]
Predicted Effect probably damaging
Transcript: ENSMUST00000088827
AA Change: Y203C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086207
Gene: ENSMUSG00000022610
AA Change: Y203C

DomainStartEndE-ValueType
S_TKc 27 311 1.63e-96 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231056
Meta Mutation Damage Score 0.538 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 97.8%
  • 10x: 90.3%
  • 20x: 69.2%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Activation of members of the mitogen-activated protein kinase family is a major mechanism for transduction of extracellular signals. Stress-activated protein kinases are one subclass of MAP kinases. The protein encoded by this gene functions as a signal transducer during differentiation of myoblasts to myotubes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with no obvious abnormalities. Mice homozygous for a conditional allele activated in muscle cell exhibit decreased endurance exercise-induced mitochondrial biogenesis and angiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,876,718 S14P probably damaging Het
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
Alg10b T C 15: 90,227,865 F304S possibly damaging Het
Ank3 C T 10: 69,882,539 S540F probably damaging Het
Arhgef16 T C 4: 154,280,889 N590D probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Cilp T A 9: 65,280,316 L1231Q possibly damaging Het
Cyp4x1 A G 4: 115,126,555 probably benign Het
Disp2 G A 2: 118,806,418 probably null Het
Dnah5 T C 15: 28,421,690 L3896P probably damaging Het
Dpp8 T C 9: 65,053,832 probably null Het
Esp4 A C 17: 40,602,371 N43T probably benign Het
Fat3 T C 9: 15,996,774 D2644G probably damaging Het
Fgd5 A G 6: 91,987,631 K124E probably benign Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Hexdc A G 11: 121,221,267 I438V probably benign Het
Lonp2 A G 8: 86,636,540 E262G probably benign Het
Ly6h G T 15: 75,565,172 S118R unknown Het
Mapk15 A G 15: 75,998,155 T375A probably benign Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Nsd3 A G 8: 25,713,380 D1307G probably benign Het
Olfr1009 C A 2: 85,722,276 Y290* probably null Het
Osbpl11 T C 16: 33,227,212 F515S probably damaging Het
Pcdh15 T C 10: 74,170,560 V90A probably damaging Het
Ptpn4 T C 1: 119,684,540 D41G probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Sez6l2 C A 7: 126,961,812 P483Q probably damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Sgo2b A G 8: 63,926,855 L981P probably damaging Het
Sh3d19 A G 3: 86,107,327 D475G possibly damaging Het
Shprh T C 10: 11,213,482 S1655P possibly damaging Het
Slc25a12 G A 2: 71,312,568 probably benign Het
Strc A G 2: 121,372,077 probably benign Het
Ttc22 G A 4: 106,623,031 V161M probably damaging Het
Unc79 T C 12: 103,112,667 L1504P probably damaging Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Other mutations in Mapk12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01843:Mapk12 APN 15 89137466 splice site probably benign
R0106:Mapk12 UTSW 15 89132984 unclassified probably benign
R0106:Mapk12 UTSW 15 89132984 unclassified probably benign
R0523:Mapk12 UTSW 15 89135645 missense probably benign 0.12
R1148:Mapk12 UTSW 15 89134623 missense probably damaging 1.00
R1667:Mapk12 UTSW 15 89140141 missense probably damaging 1.00
R3887:Mapk12 UTSW 15 89135637 missense possibly damaging 0.93
R4901:Mapk12 UTSW 15 89134638 nonsense probably null
R7011:Mapk12 UTSW 15 89135600 missense probably damaging 1.00
R7080:Mapk12 UTSW 15 89133147 missense not run
R7105:Mapk12 UTSW 15 89131158 missense not run
X0022:Mapk12 UTSW 15 89137427 missense probably damaging 0.99
Predicted Primers
Posted On2014-01-15