Incidental Mutation 'R1148:Alg10b'
ID102541
Institutional Source Beutler Lab
Gene Symbol Alg10b
Ensembl Gene ENSMUSG00000075470
Gene Nameasparagine-linked glycosylation 10B (alpha-1,2-glucosyltransferase)
SynonymsDeaf1, LOC380959, nse5
MMRRC Submission 039221-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R1148 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location90224311-90233471 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90227865 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 304 (F304S)
Ref Sequence ENSEMBL: ENSMUSP00000097882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100309] [ENSMUST00000231200]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100309
AA Change: F304S

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097882
Gene: ENSMUSG00000075470
AA Change: F304S

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DIE2_ALG10 31 428 2.4e-133 PFAM
transmembrane domain 435 457 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183650
Predicted Effect probably benign
Transcript: ENSMUST00000231200
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 97.8%
  • 10x: 90.3%
  • 20x: 69.2%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-associated protein that adds the third glucose residue to the lipid-linked oligosaccharide precursor for N-linked glycosylation. That is, it transfers the terminal glucose from dolichyl phosphate glucose (Dol-P-Glc) onto the lipid-linked oligosaccharide Glc2Man9GlcNAc(2)-PP-Dol. The rat protein homolog was shown to specifically modulate the gating function of the rat neuronal ether-a-go-go (EAG) potassium ion channel. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for an ENU induced allele exhibit deafness associated with cochlear outer hair cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,876,718 S14P probably damaging Het
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
Ank3 C T 10: 69,882,539 S540F probably damaging Het
Arhgef16 T C 4: 154,280,889 N590D probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Cilp T A 9: 65,280,316 L1231Q possibly damaging Het
Cyp4x1 A G 4: 115,126,555 probably benign Het
Disp2 G A 2: 118,806,418 probably null Het
Dnah5 T C 15: 28,421,690 L3896P probably damaging Het
Dpp8 T C 9: 65,053,832 probably null Het
Esp4 A C 17: 40,602,371 N43T probably benign Het
Fat3 T C 9: 15,996,774 D2644G probably damaging Het
Fgd5 A G 6: 91,987,631 K124E probably benign Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Hexdc A G 11: 121,221,267 I438V probably benign Het
Lonp2 A G 8: 86,636,540 E262G probably benign Het
Ly6h G T 15: 75,565,172 S118R unknown Het
Mapk12 T C 15: 89,134,623 Y203C probably damaging Het
Mapk15 A G 15: 75,998,155 T375A probably benign Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Nsd3 A G 8: 25,713,380 D1307G probably benign Het
Olfr1009 C A 2: 85,722,276 Y290* probably null Het
Osbpl11 T C 16: 33,227,212 F515S probably damaging Het
Pcdh15 T C 10: 74,170,560 V90A probably damaging Het
Ptpn4 T C 1: 119,684,540 D41G probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Sez6l2 C A 7: 126,961,812 P483Q probably damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Sgo2b A G 8: 63,926,855 L981P probably damaging Het
Sh3d19 A G 3: 86,107,327 D475G possibly damaging Het
Shprh T C 10: 11,213,482 S1655P possibly damaging Het
Slc25a12 G A 2: 71,312,568 probably benign Het
Strc A G 2: 121,372,077 probably benign Het
Ttc22 G A 4: 106,623,031 V161M probably damaging Het
Unc79 T C 12: 103,112,667 L1504P probably damaging Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Other mutations in Alg10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Alg10b APN 15 90228389 utr 3 prime probably benign
IGL01472:Alg10b APN 15 90227697 missense possibly damaging 0.91
IGL02512:Alg10b APN 15 90227549 missense probably benign
IGL03402:Alg10b APN 15 90228329 nonsense probably null
R1148:Alg10b UTSW 15 90227865 missense possibly damaging 0.67
R1384:Alg10b UTSW 15 90227582 missense possibly damaging 0.49
R1611:Alg10b UTSW 15 90225781 missense probably damaging 1.00
R2113:Alg10b UTSW 15 90225657 missense probably damaging 1.00
R3013:Alg10b UTSW 15 90227556 missense possibly damaging 0.81
R3078:Alg10b UTSW 15 90227936 missense probably benign 0.42
R4629:Alg10b UTSW 15 90227745 missense probably benign 0.00
R4633:Alg10b UTSW 15 90228294 missense probably benign
R7096:Alg10b UTSW 15 90227361 missense not run
Predicted Primers
Posted On2014-01-15