Incidental Mutation 'R0042:Il17ra'
ID102562
Institutional Source Beutler Lab
Gene Symbol Il17ra
Ensembl Gene ENSMUSG00000002897
Gene Nameinterleukin 17 receptor A
SynonymsVDw217, Il17r
MMRRC Submission 038336-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R0042 (G1)
Quality Score69
Status Validated
Chromosome6
Chromosomal Location120463247-120487559 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 120472125 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000002976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002976]
Predicted Effect probably benign
Transcript: ENSMUST00000002976
SMART Domains Protein: ENSMUSP00000002976
Gene: ENSMUSG00000002897

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:IL17R_fnIII_D1 48 198 1.3e-70 PFAM
Pfam:IL17R_fnIII_D2 199 303 9.6e-53 PFAM
transmembrane domain 321 343 N/A INTRINSIC
Pfam:SEFIR 380 539 1.5e-51 PFAM
low complexity region 747 765 N/A INTRINSIC
low complexity region 801 830 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204239
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interleukin 17A (IL17A) is a proinflammatory cytokine secreted by activated T-lymphocytes. It is a potent inducer of the maturation of CD34-positive hematopoietic precursors into neutrophils. The transmembrane protein encoded by this gene (interleukin 17A receptor; IL17RA) is a ubiquitous type I membrane glycoprotein that binds with low affinity to interleukin 17A. Interleukin 17A and its receptor play a pathogenic role in many inflammatory and autoimmune diseases such as rheumatoid arthritis. Like other cytokine receptors, this receptor likely has a multimeric structure. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed neutrophil recruitment and enhanced susceptibility to intranasal infection by Klibsiella pneumoniae. Mice homozygous for a different knock-out allele exhibit delayed and milder IMQ-induced psoriasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik C A 17: 25,947,982 E194* probably null Het
Abca1 C T 4: 53,059,245 probably benign Het
Acr T A 15: 89,574,332 H405Q probably benign Het
Adad1 T C 3: 37,083,173 probably benign Het
Alox5ap T C 5: 149,279,259 probably benign Het
Ank2 T C 3: 126,936,631 D3568G probably damaging Het
Atl3 T G 19: 7,529,023 I306S probably damaging Het
Atr T A 9: 95,927,356 probably benign Het
Ccnb2 A G 9: 70,419,053 V34A probably benign Het
Cdh12 A C 15: 21,537,677 probably benign Het
Cib1 C T 7: 80,230,378 V45M probably benign Het
Col6a6 T C 9: 105,780,697 E772G possibly damaging Het
Dmxl1 C A 18: 49,864,035 T466K probably benign Het
Dym T C 18: 75,125,539 probably null Het
Enpp3 A C 10: 24,774,824 F805V probably damaging Het
Eya1 T C 1: 14,184,489 D373G probably damaging Het
Gpr179 C T 11: 97,334,931 V2133I probably benign Het
Grb10 G T 11: 11,936,798 H435Q probably damaging Het
Gzmm T C 10: 79,694,565 I190T probably benign Het
Helt T C 8: 46,292,396 Y150C probably damaging Het
Hrg A T 16: 22,961,136 probably benign Het
Inhbc A G 10: 127,357,433 I238T probably benign Het
Itgb3 A G 11: 104,667,140 T787A possibly damaging Het
Jakmip2 T G 18: 43,552,145 probably benign Het
Krt4 T G 15: 101,922,752 probably benign Het
Lgsn C T 1: 31,190,453 T85I probably benign Het
Metap1 C T 3: 138,472,157 V217I probably benign Het
Mib2 A T 4: 155,659,440 C48* probably null Het
Mroh4 T A 15: 74,610,305 I768F probably damaging Het
Npas3 T A 12: 54,048,841 D361E probably damaging Het
Obscn A G 11: 59,052,585 L4246P probably damaging Het
Olfr1097 A G 2: 86,890,491 I228T probably damaging Het
Olfr1251 A C 2: 89,667,454 V144G probably benign Het
Olfr860 A G 9: 19,845,779 M280T probably benign Het
P4hb G A 11: 120,568,266 R134C probably damaging Het
Plcb3 T C 19: 6,966,420 D71G probably damaging Het
Prex2 T A 1: 11,080,081 V159E probably damaging Het
Prpsap1 T A 11: 116,479,656 K158N probably benign Het
Ptger1 G T 8: 83,668,166 V91L probably benign Het
Rdh10 T C 1: 16,108,036 probably benign Het
Rgs9bp C A 7: 35,585,033 R63L probably damaging Het
Slc13a5 A T 11: 72,259,114 V173E probably benign Het
Spata31 A T 13: 64,922,563 I842L probably benign Het
Stk32b A C 5: 37,716,748 D13E probably benign Het
Svep1 T C 4: 58,123,192 D708G possibly damaging Het
Taar6 T C 10: 23,985,123 D175G probably benign Het
Thbs1 A C 2: 118,122,877 D925A probably damaging Het
Tnr A T 1: 159,887,025 T825S probably benign Het
Ttc23l A C 15: 10,551,541 L33W probably damaging Het
Ttc39d T C 17: 80,215,950 Y13H probably benign Het
Vmn2r102 C A 17: 19,660,589 P64Q probably damaging Het
Vps11 G T 9: 44,356,291 Y341* probably null Het
Vsig8 T C 1: 172,560,358 V5A possibly damaging Het
Vwce C T 19: 10,646,813 A356V probably benign Het
Other mutations in Il17ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Il17ra APN 6 120481465 missense probably damaging 1.00
IGL01413:Il17ra APN 6 120475581 missense probably benign 0.00
IGL01418:Il17ra APN 6 120475581 missense probably benign 0.00
IGL03215:Il17ra APN 6 120472114 missense probably damaging 1.00
IGL03047:Il17ra UTSW 6 120481226 missense probably damaging 1.00
R0042:Il17ra UTSW 6 120472125 splice site probably benign
R0365:Il17ra UTSW 6 120478449 missense probably benign 0.03
R0391:Il17ra UTSW 6 120476979 splice site probably benign
R0470:Il17ra UTSW 6 120481806 missense probably benign 0.01
R0599:Il17ra UTSW 6 120481505 missense probably damaging 1.00
R1525:Il17ra UTSW 6 120473790 missense probably damaging 0.98
R1900:Il17ra UTSW 6 120477394 critical splice acceptor site probably null
R1972:Il17ra UTSW 6 120482216 missense probably benign 0.01
R4192:Il17ra UTSW 6 120481511 missense probably damaging 1.00
R4923:Il17ra UTSW 6 120477445 missense possibly damaging 0.94
R5009:Il17ra UTSW 6 120482207 missense probably benign 0.00
R5133:Il17ra UTSW 6 120481553 missense possibly damaging 0.81
R5411:Il17ra UTSW 6 120481442 missense probably damaging 1.00
R5548:Il17ra UTSW 6 120478473 missense probably benign 0.23
R6137:Il17ra UTSW 6 120475582 missense probably benign 0.23
R6190:Il17ra UTSW 6 120475273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCACCTCCTCTGCTGGACAAAG -3'
(R):5'- ACCACTGATGCTGTGACAAGCTG -3'

Sequencing Primer
(F):5'- TTGACTACTTGGCAGCAGAGC -3'
(R):5'- CAGGCATAGTTAGATGCACTAGG -3'
Posted On2014-01-15