Incidental Mutation 'R0042:Gzmm'
ID102566
Institutional Source Beutler Lab
Gene Symbol Gzmm
Ensembl Gene ENSMUSG00000054206
Gene Namegranzyme M (lymphocyte met-ase 1)
SynonymsLmet1
MMRRC Submission 038336-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.046) question?
Stock #R0042 (G1)
Quality Score48
Status Validated
Chromosome10
Chromosomal Location79689020-79695261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79694565 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 190 (I190T)
Ref Sequence ENSEMBL: ENSMUSP00000020549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020549]
Predicted Effect probably benign
Transcript: ENSMUST00000020549
AA Change: I190T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020549
Gene: ENSMUSG00000054206
AA Change: I190T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Tryp_SPc 26 251 4.6e-74 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151213
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of a family of cytotoxic lymphocyte serine proteases called granzymes, which are expressed by cytotoxic T lymphocytes and natural killer cells. This protein belongs to a subfamily of granzymes that cleave after methionine residues. Natural killer cell development, homeostasis and cytotoxicity are normal in mice deficient for this gene, but they demonstrate increased susceptibility to murine cytomegalovirus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-in allele display normal immune homeostasis, normal NK cell cytotoxicity and a normal response to ectromelia virus infection, but show a transient but significant increase in susceptibility to infection with the murine cytomegalovirus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik C A 17: 25,947,982 E194* probably null Het
Abca1 C T 4: 53,059,245 probably benign Het
Acr T A 15: 89,574,332 H405Q probably benign Het
Adad1 T C 3: 37,083,173 probably benign Het
Alox5ap T C 5: 149,279,259 probably benign Het
Ank2 T C 3: 126,936,631 D3568G probably damaging Het
Atl3 T G 19: 7,529,023 I306S probably damaging Het
Atr T A 9: 95,927,356 probably benign Het
Ccnb2 A G 9: 70,419,053 V34A probably benign Het
Cdh12 A C 15: 21,537,677 probably benign Het
Cib1 C T 7: 80,230,378 V45M probably benign Het
Col6a6 T C 9: 105,780,697 E772G possibly damaging Het
Dmxl1 C A 18: 49,864,035 T466K probably benign Het
Dym T C 18: 75,125,539 probably null Het
Enpp3 A C 10: 24,774,824 F805V probably damaging Het
Eya1 T C 1: 14,184,489 D373G probably damaging Het
Gpr179 C T 11: 97,334,931 V2133I probably benign Het
Grb10 G T 11: 11,936,798 H435Q probably damaging Het
Helt T C 8: 46,292,396 Y150C probably damaging Het
Hrg A T 16: 22,961,136 probably benign Het
Il17ra T C 6: 120,472,125 probably benign Het
Inhbc A G 10: 127,357,433 I238T probably benign Het
Itgb3 A G 11: 104,667,140 T787A possibly damaging Het
Jakmip2 T G 18: 43,552,145 probably benign Het
Krt4 T G 15: 101,922,752 probably benign Het
Lgsn C T 1: 31,190,453 T85I probably benign Het
Metap1 C T 3: 138,472,157 V217I probably benign Het
Mib2 A T 4: 155,659,440 C48* probably null Het
Mroh4 T A 15: 74,610,305 I768F probably damaging Het
Npas3 T A 12: 54,048,841 D361E probably damaging Het
Obscn A G 11: 59,052,585 L4246P probably damaging Het
Olfr1097 A G 2: 86,890,491 I228T probably damaging Het
Olfr1251 A C 2: 89,667,454 V144G probably benign Het
Olfr860 A G 9: 19,845,779 M280T probably benign Het
P4hb G A 11: 120,568,266 R134C probably damaging Het
Plcb3 T C 19: 6,966,420 D71G probably damaging Het
Prex2 T A 1: 11,080,081 V159E probably damaging Het
Prpsap1 T A 11: 116,479,656 K158N probably benign Het
Ptger1 G T 8: 83,668,166 V91L probably benign Het
Rdh10 T C 1: 16,108,036 probably benign Het
Rgs9bp C A 7: 35,585,033 R63L probably damaging Het
Slc13a5 A T 11: 72,259,114 V173E probably benign Het
Spata31 A T 13: 64,922,563 I842L probably benign Het
Stk32b A C 5: 37,716,748 D13E probably benign Het
Svep1 T C 4: 58,123,192 D708G possibly damaging Het
Taar6 T C 10: 23,985,123 D175G probably benign Het
Thbs1 A C 2: 118,122,877 D925A probably damaging Het
Tnr A T 1: 159,887,025 T825S probably benign Het
Ttc23l A C 15: 10,551,541 L33W probably damaging Het
Ttc39d T C 17: 80,215,950 Y13H probably benign Het
Vmn2r102 C A 17: 19,660,589 P64Q probably damaging Het
Vps11 G T 9: 44,356,291 Y341* probably null Het
Vsig8 T C 1: 172,560,358 V5A possibly damaging Het
Vwce C T 19: 10,646,813 A356V probably benign Het
Other mutations in Gzmm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Gzmm APN 10 79695062 missense probably benign 0.18
IGL02967:Gzmm APN 10 79695063 missense possibly damaging 0.88
IGL03162:Gzmm APN 10 79692956 missense probably damaging 1.00
R0042:Gzmm UTSW 10 79694565 missense probably benign
R4804:Gzmm UTSW 10 79695056 missense probably benign 0.00
R5340:Gzmm UTSW 10 79695073 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGAATGTCAAACCACTAGCTCTGCC -3'
(R):5'- GCTTCCTGACTTCCAACCTAGACAC -3'

Sequencing Primer
(F):5'- TAGCTCTGCCAAGAAAGCC -3'
(R):5'- ttttaccctcccagtttccg -3'
Posted On2014-01-15