Incidental Mutation 'R0042:Prpsap1'
ID102570
Institutional Source Beutler Lab
Gene Symbol Prpsap1
Ensembl Gene ENSMUSG00000015869
Gene Namephosphoribosyl pyrophosphate synthetase-associated protein 1
Synonyms5730409F23Rik, PAP39
MMRRC Submission 038336-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.258) question?
Stock #R0042 (G1)
Quality Score24
Status Validated
Chromosome11
Chromosomal Location116470845-116494202 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116479656 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 158 (K158N)
Ref Sequence ENSEMBL: ENSMUSP00000119576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106391] [ENSMUST00000135196] [ENSMUST00000152496]
Predicted Effect probably benign
Transcript: ENSMUST00000106391
AA Change: K153N

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101999
Gene: ENSMUSG00000015869
AA Change: K153N

DomainStartEndE-ValueType
low complexity region 5 34 N/A INTRINSIC
Pfam:Pribosyltran_N 38 155 4.8e-41 PFAM
Pfam:Pribosyl_synth 196 379 1.1e-102 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130835
Predicted Effect probably benign
Transcript: ENSMUST00000135196
AA Change: K158N

PolyPhen 2 Score 0.419 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119576
Gene: ENSMUSG00000015869
AA Change: K158N

DomainStartEndE-ValueType
low complexity region 5 34 N/A INTRINSIC
Pfam:Pribosyltran_N 38 160 2.9e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142480
Predicted Effect probably benign
Transcript: ENSMUST00000152496
AA Change: K117N

PolyPhen 2 Score 0.179 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115982
Gene: ENSMUSG00000015869
AA Change: K117N

DomainStartEndE-ValueType
Pfam:Pribosyltran_N 17 119 1.7e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152874
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik C A 17: 25,947,982 E194* probably null Het
Abca1 C T 4: 53,059,245 probably benign Het
Acr T A 15: 89,574,332 H405Q probably benign Het
Adad1 T C 3: 37,083,173 probably benign Het
Alox5ap T C 5: 149,279,259 probably benign Het
Ank2 T C 3: 126,936,631 D3568G probably damaging Het
Atl3 T G 19: 7,529,023 I306S probably damaging Het
Atr T A 9: 95,927,356 probably benign Het
Ccnb2 A G 9: 70,419,053 V34A probably benign Het
Cdh12 A C 15: 21,537,677 probably benign Het
Cib1 C T 7: 80,230,378 V45M probably benign Het
Col6a6 T C 9: 105,780,697 E772G possibly damaging Het
Dmxl1 C A 18: 49,864,035 T466K probably benign Het
Dym T C 18: 75,125,539 probably null Het
Enpp3 A C 10: 24,774,824 F805V probably damaging Het
Eya1 T C 1: 14,184,489 D373G probably damaging Het
Gpr179 C T 11: 97,334,931 V2133I probably benign Het
Grb10 G T 11: 11,936,798 H435Q probably damaging Het
Gzmm T C 10: 79,694,565 I190T probably benign Het
Helt T C 8: 46,292,396 Y150C probably damaging Het
Hrg A T 16: 22,961,136 probably benign Het
Il17ra T C 6: 120,472,125 probably benign Het
Inhbc A G 10: 127,357,433 I238T probably benign Het
Itgb3 A G 11: 104,667,140 T787A possibly damaging Het
Jakmip2 T G 18: 43,552,145 probably benign Het
Krt4 T G 15: 101,922,752 probably benign Het
Lgsn C T 1: 31,190,453 T85I probably benign Het
Metap1 C T 3: 138,472,157 V217I probably benign Het
Mib2 A T 4: 155,659,440 C48* probably null Het
Mroh4 T A 15: 74,610,305 I768F probably damaging Het
Npas3 T A 12: 54,048,841 D361E probably damaging Het
Obscn A G 11: 59,052,585 L4246P probably damaging Het
Olfr1097 A G 2: 86,890,491 I228T probably damaging Het
Olfr1251 A C 2: 89,667,454 V144G probably benign Het
Olfr860 A G 9: 19,845,779 M280T probably benign Het
P4hb G A 11: 120,568,266 R134C probably damaging Het
Plcb3 T C 19: 6,966,420 D71G probably damaging Het
Prex2 T A 1: 11,080,081 V159E probably damaging Het
Ptger1 G T 8: 83,668,166 V91L probably benign Het
Rdh10 T C 1: 16,108,036 probably benign Het
Rgs9bp C A 7: 35,585,033 R63L probably damaging Het
Slc13a5 A T 11: 72,259,114 V173E probably benign Het
Spata31 A T 13: 64,922,563 I842L probably benign Het
Stk32b A C 5: 37,716,748 D13E probably benign Het
Svep1 T C 4: 58,123,192 D708G possibly damaging Het
Taar6 T C 10: 23,985,123 D175G probably benign Het
Thbs1 A C 2: 118,122,877 D925A probably damaging Het
Tnr A T 1: 159,887,025 T825S probably benign Het
Ttc23l A C 15: 10,551,541 L33W probably damaging Het
Ttc39d T C 17: 80,215,950 Y13H probably benign Het
Vmn2r102 C A 17: 19,660,589 P64Q probably damaging Het
Vps11 G T 9: 44,356,291 Y341* probably null Het
Vsig8 T C 1: 172,560,358 V5A possibly damaging Het
Vwce C T 19: 10,646,813 A356V probably benign Het
Other mutations in Prpsap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0684:Prpsap1 UTSW 11 116471491 missense probably damaging 1.00
R1538:Prpsap1 UTSW 11 116479708 missense probably benign 0.09
R2429:Prpsap1 UTSW 11 116472235 missense probably damaging 1.00
R3415:Prpsap1 UTSW 11 116478584 missense probably benign 0.01
R3417:Prpsap1 UTSW 11 116478584 missense probably benign 0.01
R4035:Prpsap1 UTSW 11 116473008 missense probably benign 0.17
R5223:Prpsap1 UTSW 11 116488148 missense probably benign 0.09
R6216:Prpsap1 UTSW 11 116471413 missense probably damaging 1.00
R6875:Prpsap1 UTSW 11 116471438 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCTGAAGAATGTCACCTCAGCC -3'
(R):5'- TTGAGTGACCACTGTAGCTGACCC -3'

Sequencing Primer
(F):5'- GAATGTCACCTCAGCCCATAC -3'
(R):5'- GAGGAGCTGTTATACATACTTCCC -3'
Posted On2014-01-15