Incidental Mutation 'R1284:C130026I21Rik'
ID150644
Institutional Source Beutler Lab
Gene Symbol C130026I21Rik
Ensembl Gene ENSMUSG00000052477
Gene NameRIKEN cDNA C130026I21 gene
SynonymsOTTMUSG00000029174
MMRRC Submission 039350-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R1284 (G1)
Quality Score86
Status Not validated
Chromosome1
Chromosomal Location84992690-85270566 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 85270055 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 4 (G4S)
Ref Sequence ENSEMBL: ENSMUSP00000091224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064341] [ENSMUST00000093506] [ENSMUST00000159582] [ENSMUST00000161267]
Predicted Effect probably damaging
Transcript: ENSMUST00000064341
AA Change: G4S

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066587
Gene: ENSMUSG00000052477
AA Change: G4S

DomainStartEndE-ValueType
Pfam:Sp100 23 125 2.8e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000093506
AA Change: G4S

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091224
Gene: ENSMUSG00000052477
AA Change: G4S

DomainStartEndE-ValueType
Pfam:Sp100 24 122 1.1e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000094774
Predicted Effect probably damaging
Transcript: ENSMUST00000159582
AA Change: G4S

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125160
Gene: ENSMUSG00000052477
AA Change: G4S

DomainStartEndE-ValueType
Pfam:Sp100 23 125 6.1e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159849
Predicted Effect probably damaging
Transcript: ENSMUST00000161267
AA Change: G4S

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124435
Gene: ENSMUSG00000052477
AA Change: G4S

DomainStartEndE-ValueType
Pfam:Sp100 23 119 1.8e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166777
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 3 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik G A 5: 30,480,507 G66E probably damaging Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Gm4778 A G 3: 94,265,795 M37V probably benign Het
Other mutations in C130026I21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01866:C130026I21Rik APN 1 85254186 intron probably benign
IGL01876:C130026I21Rik APN 1 85254186 intron probably benign
IGL01880:C130026I21Rik APN 1 85254186 intron probably benign
IGL01883:C130026I21Rik APN 1 85254186 intron probably benign
IGL01886:C130026I21Rik APN 1 85254186 intron probably benign
IGL01888:C130026I21Rik APN 1 85254186 intron probably benign
IGL01893:C130026I21Rik APN 1 85254186 intron probably benign
IGL01898:C130026I21Rik APN 1 85254186 intron probably benign
IGL01906:C130026I21Rik APN 1 85254186 intron probably benign
IGL01908:C130026I21Rik APN 1 85254186 intron probably benign
IGL01909:C130026I21Rik APN 1 85254186 intron probably benign
IGL01916:C130026I21Rik APN 1 85254186 intron probably benign
IGL01918:C130026I21Rik APN 1 85254186 intron probably benign
IGL01920:C130026I21Rik APN 1 85254186 intron probably benign
IGL01923:C130026I21Rik APN 1 85254186 intron probably benign
IGL01928:C130026I21Rik APN 1 85254186 intron probably benign
IGL01933:C130026I21Rik APN 1 85254186 intron probably benign
IGL01945:C130026I21Rik APN 1 85254186 intron probably benign
IGL01949:C130026I21Rik APN 1 85254186 intron probably benign
IGL01951:C130026I21Rik APN 1 85254186 intron probably benign
IGL01952:C130026I21Rik APN 1 85254186 intron probably benign
PIT4131001:C130026I21Rik UTSW 1 85245674 intron probably benign
PIT4142001:C130026I21Rik UTSW 1 85245674 intron probably benign
R0067:C130026I21Rik UTSW 1 85270052 missense probably benign 0.00
R0367:C130026I21Rik UTSW 1 85270103 start gained probably benign
R0389:C130026I21Rik UTSW 1 85270052 missense probably benign 0.00
R1620:C130026I21Rik UTSW 1 85254186 intron probably benign
R1622:C130026I21Rik UTSW 1 85254186 intron probably benign
R1671:C130026I21Rik UTSW 1 85257385 critical splice donor site probably null
R3115:C130026I21Rik UTSW 1 85257385 intron probably benign
R4120:C130026I21Rik UTSW 1 85259821 missense possibly damaging 0.82
R4223:C130026I21Rik UTSW 1 85112557 missense probably damaging 0.98
R4947:C130026I21Rik UTSW 1 85112482 missense probably damaging 1.00
R4996:C130026I21Rik UTSW 1 85247094 missense probably benign 0.12
R5152:C130026I21Rik UTSW 1 85261860 missense probably benign 0.04
R6614:C130026I21Rik UTSW 1 85202060 intron probably null
Predicted Primers PCR Primer
(F):5'- tccaactaaacccagtTCTTCTTTTCCTTATG -3'
(R):5'- CACACCCGACTTTTCCTACTCTGCT -3'

Sequencing Primer
(F):5'- GAGATCACTGTCTCAAATATCTGTG -3'
(R):5'- TTCCAAGTCTGAGAGACTGC -3'
Posted On2014-01-29