Incidental Mutation 'R1284:Gm4778'
ID150646
Institutional Source Beutler Lab
Gene Symbol Gm4778
Ensembl Gene ENSMUSG00000089696
Gene Namepredicted gene 4778
Synonyms
MMRRC Submission 039350-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R1284 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location94264036-94266784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94265795 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 37 (M37V)
Ref Sequence ENSEMBL: ENSMUSP00000096477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098878] [ENSMUST00000159517]
Predicted Effect probably benign
Transcript: ENSMUST00000098878
AA Change: M37V

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000096477
Gene: ENSMUSG00000089696
AA Change: M37V

DomainStartEndE-ValueType
MATH 25 134 6.01e-8 SMART
BTB 192 291 7.66e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159517
AA Change: M33V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000123868
Gene: ENSMUSG00000089696
AA Change: M33V

DomainStartEndE-ValueType
MATH 21 130 6.01e-8 SMART
BTB 188 287 7.66e-26 SMART
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 3 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik G A 5: 30,480,507 G66E probably damaging Het
C130026I21Rik C T 1: 85,270,055 G4S probably damaging Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Other mutations in Gm4778
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01767:Gm4778 APN 3 94266484 missense probably benign 0.00
IGL02032:Gm4778 APN 3 94266333 missense probably damaging 1.00
IGL02694:Gm4778 APN 3 94266152 missense probably benign
IGL03171:Gm4778 APN 3 94266455 missense probably benign 0.00
R0195:Gm4778 UTSW 3 94265922 missense possibly damaging 0.79
R0739:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1064:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1149:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1149:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1150:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1152:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1286:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1287:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1349:Gm4778 UTSW 3 94266128 missense possibly damaging 0.94
R1358:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1372:Gm4778 UTSW 3 94266128 missense possibly damaging 0.94
R1383:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1399:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1756:Gm4778 UTSW 3 94266218 missense probably benign
R1996:Gm4778 UTSW 3 94265711 missense probably benign 0.00
R2679:Gm4778 UTSW 3 94265910 missense probably damaging 1.00
R2878:Gm4778 UTSW 3 94266480 missense possibly damaging 0.69
R5108:Gm4778 UTSW 3 94265835 missense probably damaging 1.00
R5706:Gm4778 UTSW 3 94266652 missense possibly damaging 0.91
R6251:Gm4778 UTSW 3 94265901 missense probably damaging 1.00
R6928:Gm4778 UTSW 3 94266548 missense probably benign 0.31
R7091:Gm4778 UTSW 3 94266638 missense probably damaging 1.00
R7264:Gm4778 UTSW 3 94265738 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGGGAGAGGGAGATTTAAAACTCACCAT -3'
(R):5'- TCACCTGGCAGCAGAGGGTAA -3'

Sequencing Primer
(F):5'- TGGGGAAATTTAGGAGAAATTGACAC -3'
(R):5'- GAAAGCTAACGACTTTCGTGCTC -3'
Posted On2014-01-29