Mutagenetix > Incidental Mutation

Incidental Mutation 'R1285:Hlx'

150654

Institutional Source

Beutler Lab

Gene Symbol

Hlx

Ensembl Gene

ENSMUSG00000039377

Gene Name

H2.0-like homeobox

Synonyms

Hlx1

MMRRC Submission

039351-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1285 (G1)

Quality Score

143

Status

Not validated

Chromosome

Chromosomal Location

184459340-184464690 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 184464184 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Aspartic acid at position 52 (A52D)

Ref Sequence

ENSEMBL: ENSMUSP00000040505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048572] [ENSMUST00000174257]

AlphaFold

Q61670

Predicted Effect

probably damaging
Transcript: ENSMUST00000048572
AA Change: A52D

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000040505
Gene: ENSMUSG00000039377
AA Change: A52D

Domain	Start	End	E-Value	Type
low complexity region	52	63	N/A	INTRINSIC
low complexity region	123	149	N/A	INTRINSIC
low complexity region	157	168	N/A	INTRINSIC
HOX	271	335	2.32e-22	SMART
low complexity region	353	379	N/A	INTRINSIC
low complexity region	405	434	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000174257

SMART Domains

Protein: ENSMUSP00000134728
Gene: ENSMUSG00000039377

Domain	Start	End	E-Value	Type
low complexity region	52	63	N/A	INTRINSIC
low complexity region	123	149	N/A	INTRINSIC
low complexity region	157	168	N/A	INTRINSIC
low complexity region	221	271	N/A	INTRINSIC
low complexity region	344	357	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192139

Meta Mutation Damage Score

0.0763

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 93.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for disrputions in this gene die as embryos as a result of defective organogenesis and fetal hematopoiesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 3 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	GCC	GC	13: 59,839,412 (GRCm39)		probably null	Het
Atf2	C	T	2: 73,675,853 (GRCm39)	G123E	probably damaging	Het
Cimip2c	G	A	5: 30,637,851 (GRCm39)	G66E	probably damaging	Het

Other mutations in Hlx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00471:Hlx	APN	1	184,463,792 (GRCm39)	missense	probably damaging	1.00
IGL01074:Hlx	APN	1	184,460,010 (GRCm39)	missense	probably damaging	1.00
IGL02543:Hlx	APN	1	184,462,948 (GRCm39)	missense	probably damaging	1.00
R0522:Hlx	UTSW	1	184,463,837 (GRCm39)	missense	probably damaging	1.00
R1104:Hlx	UTSW	1	184,464,184 (GRCm39)	missense	probably damaging	0.99
R1157:Hlx	UTSW	1	184,464,184 (GRCm39)	missense	probably damaging	0.99
R1158:Hlx	UTSW	1	184,464,184 (GRCm39)	missense	probably damaging	0.99
R1286:Hlx	UTSW	1	184,464,184 (GRCm39)	missense	probably damaging	0.99
R1439:Hlx	UTSW	1	184,464,184 (GRCm39)	missense	probably damaging	0.99
R1489:Hlx	UTSW	1	184,464,184 (GRCm39)	missense	probably damaging	0.99
R1606:Hlx	UTSW	1	184,464,184 (GRCm39)	missense	probably damaging	0.99
R1974:Hlx	UTSW	1	184,464,184 (GRCm39)	missense	probably damaging	0.99
R1976:Hlx	UTSW	1	184,464,184 (GRCm39)	missense	probably damaging	0.99
R2161:Hlx	UTSW	1	184,459,838 (GRCm39)	missense	probably benign	0.12
R2162:Hlx	UTSW	1	184,462,889 (GRCm39)	splice site	probably null
R2340:Hlx	UTSW	1	184,464,184 (GRCm39)	missense	probably damaging	0.99
R2341:Hlx	UTSW	1	184,464,184 (GRCm39)	missense	probably damaging	0.99
R3237:Hlx	UTSW	1	184,464,184 (GRCm39)	missense	probably damaging	0.99
R3781:Hlx	UTSW	1	184,464,184 (GRCm39)	missense	probably damaging	0.99
R3782:Hlx	UTSW	1	184,464,184 (GRCm39)	missense	probably damaging	0.99
R5705:Hlx	UTSW	1	184,463,062 (GRCm39)	missense	probably benign	0.40
R5738:Hlx	UTSW	1	184,463,754 (GRCm39)	critical splice donor site	probably null
R6081:Hlx	UTSW	1	184,459,894 (GRCm39)	missense	probably benign
R7323:Hlx	UTSW	1	184,462,993 (GRCm39)	missense	probably benign	0.00
R7373:Hlx	UTSW	1	184,463,062 (GRCm39)	missense	probably benign	0.40
R7908:Hlx	UTSW	1	184,459,773 (GRCm39)	missense	probably benign
R7938:Hlx	UTSW	1	184,464,125 (GRCm39)	missense	probably benign	0.00
R7985:Hlx	UTSW	1	184,464,223 (GRCm39)	missense	probably benign	0.00
R8303:Hlx	UTSW	1	184,459,905 (GRCm39)	missense	probably damaging	1.00
X0018:Hlx	UTSW	1	184,459,929 (GRCm39)	missense	possibly damaging	0.72

Predicted Primers

PCR Primer
(F):5'- AGCCAGCCGGGACTTCTGAG -3'
(R):5'- GCCGCCTTTCAAGCCAAGCC -3'

Sequencing Primer
(F):5'- CCCAAGTGTGCGGTGAG -3'
(R):5'- TTTCAAGCCAAGCCAGGGG -3'

Posted On

2014-01-29