Incidental Mutation 'R1287:Atf2'
ID 150658
Institutional Source Beutler Lab
Gene Symbol Atf2
Ensembl Gene ENSMUSG00000027104
Gene Name activating transcription factor 2
Synonyms mXBP, ATF-2, CRE-BP, D130078H02Rik, Creb2
MMRRC Submission 039353-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.935) question?
Stock # R1287 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 73646853-73722983 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 73675853 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Glutamic Acid at position 123 (G123E)
Ref Sequence ENSEMBL: ENSMUSP00000118719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055833] [ENSMUST00000090802] [ENSMUST00000100009] [ENSMUST00000112007] [ENSMUST00000112010] [ENSMUST00000112016] [ENSMUST00000112017] [ENSMUST00000128531] [ENSMUST00000154456] [ENSMUST00000173010] [ENSMUST00000136958]
AlphaFold P16951
Predicted Effect probably damaging
Transcript: ENSMUST00000055833
AA Change: G206E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058521
Gene: ENSMUSG00000027104
AA Change: G206E

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
BRLZ 332 396 3.15e-21 SMART
low complexity region 437 449 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090802
AA Change: G166E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088311
Gene: ENSMUSG00000027104
AA Change: G166E

DomainStartEndE-ValueType
low complexity region 197 214 N/A INTRINSIC
low complexity region 260 276 N/A INTRINSIC
BRLZ 292 356 3.15e-21 SMART
low complexity region 397 409 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100009
AA Change: G206E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097588
Gene: ENSMUSG00000027104
AA Change: G206E

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
BRLZ 332 396 3.15e-21 SMART
low complexity region 437 449 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112007
AA Change: G166E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107638
Gene: ENSMUSG00000027104
AA Change: G166E

DomainStartEndE-ValueType
low complexity region 197 214 N/A INTRINSIC
low complexity region 260 276 N/A INTRINSIC
BRLZ 292 356 3.15e-21 SMART
low complexity region 397 409 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112010
AA Change: G166E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107641
Gene: ENSMUSG00000027104
AA Change: G166E

DomainStartEndE-ValueType
low complexity region 197 214 N/A INTRINSIC
low complexity region 260 276 N/A INTRINSIC
BRLZ 292 356 3.15e-21 SMART
low complexity region 397 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112016
SMART Domains Protein: ENSMUSP00000107647
Gene: ENSMUSG00000027104

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 139 156 N/A INTRINSIC
low complexity region 202 218 N/A INTRINSIC
BRLZ 234 298 3.15e-21 SMART
low complexity region 339 351 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112017
AA Change: G206E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107648
Gene: ENSMUSG00000027104
AA Change: G206E

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
BRLZ 332 396 3.15e-21 SMART
low complexity region 437 449 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143714
Predicted Effect possibly damaging
Transcript: ENSMUST00000128531
AA Change: G206E

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118560
Gene: ENSMUSG00000027104
AA Change: G206E

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000154456
AA Change: G123E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000173010
AA Change: G206E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133632
Gene: ENSMUSG00000027104
AA Change: G206E

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
BRLZ 332 377 1.32e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156455
Predicted Effect probably benign
Transcript: ENSMUST00000136958
SMART Domains Protein: ENSMUSP00000118357
Gene: ENSMUSG00000027104

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 139 156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124737
SMART Domains Protein: ENSMUSP00000114828
Gene: ENSMUSG00000027104

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
low complexity region 94 110 N/A INTRINSIC
BRLZ 126 190 3.89e-12 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions This protein binds to the cAMP-responsive element (CRE), an octameric palindrome. It forms a homodimer or a heterodimer with c-Jun and stimulates CRE-dependent transcription. This protein is also a histone acetyltransferase (HAT) that specifically acetylates histones H2B and H4 in vitro; thus it may represent a class of sequence-specific factors that activate transcription by direct effects on chromatin components. The encoded protein may also be involved in cell's DNA damage response independent of its role in transcriptional regulation. Several alternatively spliced transcript variants have been found for this gene [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous mutation of this gene results in increased postnatal lethality, skeletal development defects, runting, decreased hearing, inner ear and brain abnormalities, hyperactivity, and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 2 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cimip2c G A 5: 30,637,851 (GRCm39) G66E probably damaging Het
Spopfm1 A G 3: 94,173,102 (GRCm39) M37V probably benign Het
Other mutations in Atf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Atf2 APN 2 73,675,847 (GRCm39) missense possibly damaging 0.85
IGL01608:Atf2 APN 2 73,649,422 (GRCm39) missense probably damaging 1.00
IGL02112:Atf2 APN 2 73,649,381 (GRCm39) missense probably damaging 1.00
IGL02469:Atf2 APN 2 73,676,676 (GRCm39) missense probably damaging 0.99
IGL02686:Atf2 APN 2 73,675,844 (GRCm39) missense possibly damaging 0.90
IGL03381:Atf2 APN 2 73,659,012 (GRCm39) missense probably benign 0.13
R0020:Atf2 UTSW 2 73,676,628 (GRCm39) missense possibly damaging 0.81
R0020:Atf2 UTSW 2 73,676,628 (GRCm39) missense possibly damaging 0.81
R0045:Atf2 UTSW 2 73,660,200 (GRCm39) missense probably benign 0.02
R0045:Atf2 UTSW 2 73,660,200 (GRCm39) missense probably benign 0.02
R0480:Atf2 UTSW 2 73,649,500 (GRCm39) splice site probably benign
R0732:Atf2 UTSW 2 73,675,844 (GRCm39) missense possibly damaging 0.90
R1188:Atf2 UTSW 2 73,675,881 (GRCm39) missense probably damaging 0.96
R1285:Atf2 UTSW 2 73,675,853 (GRCm39) missense probably damaging 1.00
R1523:Atf2 UTSW 2 73,693,552 (GRCm39) missense probably damaging 1.00
R1622:Atf2 UTSW 2 73,684,133 (GRCm39) splice site probably null
R1731:Atf2 UTSW 2 73,675,853 (GRCm39) missense probably damaging 1.00
R1935:Atf2 UTSW 2 73,676,563 (GRCm39) missense probably damaging 1.00
R1939:Atf2 UTSW 2 73,676,563 (GRCm39) missense probably damaging 1.00
R1965:Atf2 UTSW 2 73,681,242 (GRCm39) missense possibly damaging 0.87
R2000:Atf2 UTSW 2 73,693,584 (GRCm39) critical splice acceptor site probably null
R2045:Atf2 UTSW 2 73,693,552 (GRCm39) missense probably damaging 1.00
R2256:Atf2 UTSW 2 73,675,855 (GRCm39) splice site probably null
R3147:Atf2 UTSW 2 73,681,283 (GRCm39) splice site probably null
R3890:Atf2 UTSW 2 73,693,557 (GRCm39) missense probably damaging 1.00
R4680:Atf2 UTSW 2 73,659,025 (GRCm39) splice site probably null
R4715:Atf2 UTSW 2 73,653,644 (GRCm39) missense probably damaging 1.00
R5161:Atf2 UTSW 2 73,660,134 (GRCm39) critical splice donor site probably null
R5853:Atf2 UTSW 2 73,658,813 (GRCm39) splice site probably null
R7419:Atf2 UTSW 2 73,672,777 (GRCm39) missense probably benign 0.01
R7833:Atf2 UTSW 2 73,684,229 (GRCm39) missense possibly damaging 0.94
R9202:Atf2 UTSW 2 73,649,472 (GRCm39) missense probably damaging 0.99
R9266:Atf2 UTSW 2 73,649,271 (GRCm39) missense probably benign 0.27
R9690:Atf2 UTSW 2 73,675,813 (GRCm39) missense probably benign 0.26
X0033:Atf2 UTSW 2 73,676,625 (GRCm39) missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- ACCTAGTCAAACTGGAGTGAGGTGAAT -3'
(R):5'- AGTAACTCCCAAGACCTTTCTGATGAGA -3'

Sequencing Primer
(F):5'- GGTTTCAATCCAATTATGTTTGCC -3'
(R):5'- GGAAATCCATGATTTTTCCCCAGG -3'
Posted On 2014-01-29