Incidental Mutation 'R1287:1700001C02Rik'
List |< first << previous [record 42 of 32981] next >> last >|
ID150660
Institutional Source Beutler Lab
Gene Symbol 1700001C02Rik
Ensembl Gene ENSMUSG00000029182
Gene NameRIKEN cDNA 1700001C02 gene
Synonyms
MMRRC Submission 039353-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R1287 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location30466047-30484088 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30480507 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 66 (G66E)
Ref Sequence ENSEMBL: ENSMUSP00000142583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031078] [ENSMUST00000114743] [ENSMUST00000127815] [ENSMUST00000199129]
Predicted Effect probably damaging
Transcript: ENSMUST00000031078
AA Change: G66E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031078
Gene: ENSMUSG00000029182
AA Change: G66E

DomainStartEndE-ValueType
Pfam:DUF2475 19 84 2.3e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114743
AA Change: G66E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110391
Gene: ENSMUSG00000029182
AA Change: G66E

DomainStartEndE-ValueType
Pfam:DUF2475 19 84 1e-26 PFAM
low complexity region 125 137 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000127815
AA Change: G66E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142635
Gene: ENSMUSG00000029182
AA Change: G66E

DomainStartEndE-ValueType
Pfam:DUF2475 19 84 5.6e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199129
AA Change: G66E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142583
Gene: ENSMUSG00000029182
AA Change: G66E

DomainStartEndE-ValueType
Pfam:DUF2475 19 84 3.7e-23 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 2 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atf2 C T 2: 73,845,509 G123E probably damaging Het
Gm4778 A G 3: 94,265,795 M37V probably benign Het
Other mutations in 1700001C02Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1284:1700001C02Rik UTSW 5 30480507 missense probably damaging 1.00
R1285:1700001C02Rik UTSW 5 30480507 missense probably damaging 1.00
R1286:1700001C02Rik UTSW 5 30480507 missense probably damaging 1.00
R1699:1700001C02Rik UTSW 5 30483866 critical splice acceptor site probably null
R2109:1700001C02Rik UTSW 5 30480507 missense probably damaging 1.00
R3735:1700001C02Rik UTSW 5 30482098 missense probably benign 0.03
R3736:1700001C02Rik UTSW 5 30482098 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCAGTCATCAAAAGCCCGCCTG -3'
(R):5'- CTCTGCCCCTGGAACTCTGAAAAG -3'

Sequencing Primer
(F):5'- AAAGCCCGCCTGGGAAC -3'
(R):5'- TCTGAAAAGGCAACCCTGTCTC -3'
Posted On2014-01-29