Incidental Mutation 'R1288:Cep126'
ID150672
Institutional Source Beutler Lab
Gene Symbol Cep126
Ensembl Gene ENSMUSG00000040729
Gene Namecentrosomal protein 126
SynonymsAK129341
MMRRC Submission 039354-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R1288 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location8076461-8134294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8112181 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 130 (N130K)
Ref Sequence ENSEMBL: ENSMUSP00000042904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037397]
Predicted Effect probably benign
Transcript: ENSMUST00000037397
AA Change: N130K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000042904
Gene: ENSMUSG00000040729
AA Change: N130K

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
Pfam:K1377 100 1061 N/A PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 A T 5: 129,129,007 D247V probably damaging Het
Ano5 A T 7: 51,546,872 S184C probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Atxn3 C T 12: 101,942,178 probably null Het
BC005537 A T 13: 24,804,900 E54V probably damaging Het
Ccdc150 A T 1: 54,364,458 E881V probably damaging Het
Enoph1 A G 5: 100,040,279 T21A possibly damaging Het
Fbxw28 A G 9: 109,337,293 I165T probably damaging Het
Lrp12 A T 15: 39,878,403 N305K probably damaging Het
Msl2 A G 9: 101,102,109 T561A probably benign Het
Mup21 G T 4: 62,150,697 A19E probably benign Het
Myh13 T C 11: 67,353,718 I1027T probably benign Het
Nkg7 A G 7: 43,437,662 probably null Het
Nme8 A G 13: 19,674,449 V73A possibly damaging Het
Olfr1135 G A 2: 87,671,572 A265V probably benign Het
Olfr123 T A 17: 37,795,693 L83Q probably damaging Het
Olfr138 A G 17: 38,275,223 T151A probably benign Het
Olfr68 A T 7: 103,778,042 L101Q possibly damaging Het
Olfr822 A G 10: 130,075,285 N292D probably damaging Het
Rapgef3 C A 15: 97,759,342 S267I probably benign Het
Trhde T A 10: 114,801,290 D4V probably benign Het
Vmn1r234 CTT CTTT 17: 21,229,251 probably null Het
Zfp40 T A 17: 23,182,162 I36L probably benign Het
Other mutations in Cep126
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01633:Cep126 APN 9 8103319 missense possibly damaging 0.57
IGL01967:Cep126 APN 9 8095208 splice site probably null
IGL02065:Cep126 APN 9 8099924 missense probably benign 0.09
IGL03215:Cep126 APN 9 8100530 nonsense probably null
R0064:Cep126 UTSW 9 8130182 splice site probably benign
R0064:Cep126 UTSW 9 8130182 splice site probably benign
R0184:Cep126 UTSW 9 8103395 missense probably benign 0.19
R0835:Cep126 UTSW 9 8130223 missense probably damaging 1.00
R0980:Cep126 UTSW 9 8100719 missense probably damaging 0.99
R1341:Cep126 UTSW 9 8099776 missense possibly damaging 0.78
R1351:Cep126 UTSW 9 8100086 missense probably damaging 0.99
R1484:Cep126 UTSW 9 8100553 missense possibly damaging 0.81
R1707:Cep126 UTSW 9 8100382 missense probably benign 0.00
R1732:Cep126 UTSW 9 8099761 missense probably benign
R1903:Cep126 UTSW 9 8120747 missense possibly damaging 0.58
R1968:Cep126 UTSW 9 8100908 missense probably damaging 1.00
R2216:Cep126 UTSW 9 8120678 missense probably damaging 1.00
R2260:Cep126 UTSW 9 8101748 missense possibly damaging 0.50
R2444:Cep126 UTSW 9 8101306 missense probably damaging 1.00
R4208:Cep126 UTSW 9 8100821 missense probably damaging 1.00
R4499:Cep126 UTSW 9 8101588 missense possibly damaging 0.80
R4585:Cep126 UTSW 9 8103337 missense probably damaging 0.99
R5547:Cep126 UTSW 9 8100427 missense probably damaging 0.97
R5752:Cep126 UTSW 9 8120745 nonsense probably null
R5794:Cep126 UTSW 9 8103439 missense possibly damaging 0.64
R5932:Cep126 UTSW 9 8103508 missense probably damaging 1.00
R5956:Cep126 UTSW 9 8112119 missense probably benign 0.08
R6354:Cep126 UTSW 9 8099927 missense probably damaging 1.00
R6442:Cep126 UTSW 9 8100563 missense probably benign 0.14
R6964:Cep126 UTSW 9 8112100 missense probably null 0.99
R7134:Cep126 UTSW 9 8103382 missense probably damaging 1.00
R7161:Cep126 UTSW 9 8087399 missense probably benign 0.02
R7221:Cep126 UTSW 9 8100987 nonsense probably null
X0060:Cep126 UTSW 9 8087255 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTGGTAGTGGTCAGCCTAACC -3'
(R):5'- AGATGATTCAGAGGGCATCACTTGC -3'

Sequencing Primer
(F):5'- GTGGTCAGCCTAACCACTTTAAC -3'
(R):5'- AACAGCACCTGTGTTAGGC -3'
Posted On2014-01-29