Incidental Mutation 'R1288:Olfr138'
ID150686
Institutional Source Beutler Lab
Gene Symbol Olfr138
Ensembl Gene ENSMUSG00000057443
Gene Nameolfactory receptor 138
SynonymsGA_x6K02T2PSCP-2718585-2719523, MOR256-40P, Olfr89
MMRRC Submission 039354-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R1288 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location38261035-38276410 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38275223 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 151 (T151A)
Ref Sequence ENSEMBL: ENSMUSP00000133828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071871] [ENSMUST00000172843] [ENSMUST00000173841]
Predicted Effect probably benign
Transcript: ENSMUST00000071871
AA Change: T151A

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000071767
Gene: ENSMUSG00000057443
AA Change: T151A

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 2.4e-33 PFAM
Pfam:7tm_4 139 283 8.1e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172843
AA Change: T151A

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000133698
Gene: ENSMUSG00000057443
AA Change: T151A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.5e-46 PFAM
Pfam:7tm_1 41 290 1.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173841
AA Change: T151A

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000133828
Gene: ENSMUSG00000057443
AA Change: T151A

DomainStartEndE-ValueType
Pfam:7tm_1 41 123 1.7e-15 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 A T 5: 129,129,007 D247V probably damaging Het
Ano5 A T 7: 51,546,872 S184C probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Atxn3 C T 12: 101,942,178 probably null Het
BC005537 A T 13: 24,804,900 E54V probably damaging Het
Ccdc150 A T 1: 54,364,458 E881V probably damaging Het
Cep126 A T 9: 8,112,181 N130K probably benign Het
Enoph1 A G 5: 100,040,279 T21A possibly damaging Het
Fbxw28 A G 9: 109,337,293 I165T probably damaging Het
Lrp12 A T 15: 39,878,403 N305K probably damaging Het
Msl2 A G 9: 101,102,109 T561A probably benign Het
Mup21 G T 4: 62,150,697 A19E probably benign Het
Myh13 T C 11: 67,353,718 I1027T probably benign Het
Nkg7 A G 7: 43,437,662 probably null Het
Nme8 A G 13: 19,674,449 V73A possibly damaging Het
Olfr1135 G A 2: 87,671,572 A265V probably benign Het
Olfr123 T A 17: 37,795,693 L83Q probably damaging Het
Olfr68 A T 7: 103,778,042 L101Q possibly damaging Het
Olfr822 A G 10: 130,075,285 N292D probably damaging Het
Rapgef3 C A 15: 97,759,342 S267I probably benign Het
Trhde T A 10: 114,801,290 D4V probably benign Het
Vmn1r234 CTT CTTT 17: 21,229,251 probably null Het
Zfp40 T A 17: 23,182,162 I36L probably benign Het
Other mutations in Olfr138
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Olfr138 APN 17 38274899 missense probably benign 0.01
IGL01874:Olfr138 APN 17 38275517 missense probably benign 0.32
IGL02209:Olfr138 APN 17 38275232 missense probably benign 0.00
IGL03053:Olfr138 APN 17 38274791 missense probably damaging 0.96
IGL03168:Olfr138 APN 17 38274791 missense probably damaging 0.96
R0393:Olfr138 UTSW 17 38274883 missense probably benign 0.00
R0667:Olfr138 UTSW 17 38275157 missense probably damaging 1.00
R1567:Olfr138 UTSW 17 38275568 missense possibly damaging 0.87
R1618:Olfr138 UTSW 17 38275666 synonymous probably null
R1699:Olfr138 UTSW 17 38275041 missense probably benign 0.39
R1748:Olfr138 UTSW 17 38275106 missense possibly damaging 0.50
R1862:Olfr138 UTSW 17 38275344 missense probably damaging 0.99
R2251:Olfr138 UTSW 17 38274903 missense probably benign 0.01
R3436:Olfr138 UTSW 17 38275530 missense probably damaging 1.00
R4731:Olfr138 UTSW 17 38275547 missense probably damaging 1.00
R4732:Olfr138 UTSW 17 38275547 missense probably damaging 1.00
R4733:Olfr138 UTSW 17 38275547 missense probably damaging 1.00
R5404:Olfr138 UTSW 17 38275626 nonsense probably null
R5443:Olfr138 UTSW 17 38275014 missense probably damaging 0.99
R5683:Olfr138 UTSW 17 38275546 missense possibly damaging 0.69
R6058:Olfr138 UTSW 17 38275259 missense probably damaging 0.99
R6061:Olfr138 UTSW 17 38274881 missense probably benign
R6266:Olfr138 UTSW 17 38275148 missense probably benign 0.22
X0024:Olfr138 UTSW 17 38275445 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CATTGTGCCTCAGATGCTGTTTAACC -3'
(R):5'- GTCCCTTGTGATAGATGAAGAAGGCTG -3'

Sequencing Primer
(F):5'- TGTTTAACCTGGGAAGCTCC -3'
(R):5'- CTGAAGGTACATGCTAATACCTGGAC -3'
Posted On2014-01-29