Incidental Mutation 'R1293:Gm10142'
ID150713
Institutional Source Beutler Lab
Gene Symbol Gm10142
Ensembl Gene ENSMUSG00000094146
Gene Namepredicted gene 10142
Synonyms
MMRRC Submission 039359-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R1293 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location77715807-77716169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77716035 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 77 (S77P)
Ref Sequence ENSEMBL: ENSMUSP00000135962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075421] [ENSMUST00000092366] [ENSMUST00000092370] [ENSMUST00000179767]
Predicted Effect probably benign
Transcript: ENSMUST00000075421
SMART Domains Protein: ENSMUSP00000074876
Gene: ENSMUSG00000094012

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 53 2.6e-8 PFAM
Pfam:Keratin_B2_2 29 74 9.2e-10 PFAM
low complexity region 92 105 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092366
SMART Domains Protein: ENSMUSP00000090020
Gene: ENSMUSG00000069581

DomainStartEndE-ValueType
Blast:TSPN 1 71 8e-40 BLAST
SCOP:d1c4ra_ 2 67 2e-7 SMART
low complexity region 190 200 N/A INTRINSIC
Pfam:EPTP 208 255 2.6e-22 PFAM
Pfam:EPTP 260 307 1.4e-21 PFAM
Pfam:EPTP 312 359 8.9e-14 PFAM
Pfam:EPTP 362 417 6.2e-13 PFAM
Pfam:EPTP 422 469 1.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092370
SMART Domains Protein: ENSMUSP00000090024
Gene: ENSMUSG00000069583

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 42 3.1e-6 PFAM
Pfam:Keratin_B2_2 20 68 3.1e-10 PFAM
Pfam:Keratin_B2_2 39 84 3.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179767
AA Change: S77P

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000135962
Gene: ENSMUSG00000094146
AA Change: S77P

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 53 1.7e-8 PFAM
Pfam:Keratin_B2_2 29 74 1.8e-9 PFAM
low complexity region 88 106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218482
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 G A 2: 155,551,221 R289Q probably benign Het
Adgrl4 G A 3: 151,507,444 E374K probably benign Het
Ate1 G A 7: 130,394,725 R505C probably benign Het
Cntn4 T C 6: 106,353,724 I101T probably benign Het
Dmtf1 T A 5: 9,140,383 probably null Het
Dnah17 C A 11: 118,127,137 probably null Het
Efhc1 A G 1: 20,978,772 T470A probably damaging Het
Fam118b A T 9: 35,221,425 Y313N probably damaging Het
Kat8 T C 7: 127,922,250 probably null Het
Lrp2 T C 2: 69,523,302 probably null Het
Lrrc10 A G 10: 117,045,933 T171A probably benign Het
Mcidas A G 13: 112,997,392 T137A probably benign Het
Med1 G A 11: 98,157,036 T978I possibly damaging Het
Muc6 C A 7: 141,651,990 C75F probably damaging Het
Olfm3 A G 3: 115,101,930 I154V possibly damaging Het
Olfr1382 G A 11: 49,535,566 C127Y probably damaging Het
Olfr697 A G 7: 106,741,851 C28R probably damaging Het
Olfr849 A T 9: 19,441,432 E173V probably benign Het
Olfr992 T A 2: 85,400,353 probably null Het
Rsrc1 G A 3: 67,356,279 R324Q probably damaging Het
Samd9l G T 6: 3,373,947 P1105T possibly damaging Het
Sgcb C A 5: 73,635,527 V311F probably benign Het
Siglec1 A G 2: 131,073,531 V1380A probably benign Het
Spred1 C T 2: 117,177,408 P265L probably damaging Het
Unc13b T A 4: 43,235,190 H3259Q probably damaging Het
Unc13c C T 9: 73,574,074 D1694N probably benign Het
Usp24 A G 4: 106,423,553 R2355G probably benign Het
Vmn1r53 T A 6: 90,224,214 N43Y possibly damaging Het
Wtip T C 7: 34,110,221 S359G possibly damaging Het
Zfp984 T A 4: 147,755,941 K151M possibly damaging Het
Other mutations in Gm10142
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02369:Gm10142 APN 10 77716113 missense probably benign 0.07
R0244:Gm10142 UTSW 10 77716014 unclassified probably null
R1918:Gm10142 UTSW 10 77715987 missense probably benign 0.32
R5047:Gm10142 UTSW 10 77716162 missense probably damaging 1.00
R5814:Gm10142 UTSW 10 77716123 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCCTCTACCATGTGTCACACCAG -3'
(R):5'- GGGCTTTCTAACTGCCTCATGCTG -3'

Sequencing Primer
(F):5'- GCCAGCCATCTTGCTGTG -3'
(R):5'- TCAGCAGCCAGGAGCTAC -3'
Posted On2014-01-29