Incidental Mutation 'R1289:Glcci1'
ID150731
Institutional Source Beutler Lab
Gene Symbol Glcci1
Ensembl Gene ENSMUSG00000029638
Gene Nameglucocorticoid induced transcript 1
SynonymsFam117c, GIG18, Tssn1
MMRRC Submission 039355-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R1289 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location8509600-8597548 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 8593088 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 298 (V298I)
Ref Sequence ENSEMBL: ENSMUSP00000125079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064285] [ENSMUST00000161217] [ENSMUST00000161494] [ENSMUST00000162564] [ENSMUST00000162567]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064285
AA Change: V485I

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000069444
Gene: ENSMUSG00000029638
AA Change: V485I

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 22 48 N/A INTRINSIC
low complexity region 69 110 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
Pfam:FAM117 159 468 1.7e-132 PFAM
low complexity region 493 506 N/A INTRINSIC
low complexity region 512 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161217
AA Change: V297I

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124167
Gene: ENSMUSG00000029638
AA Change: V297I

DomainStartEndE-ValueType
Pfam:FAM117 1 284 3.2e-104 PFAM
low complexity region 305 318 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161494
SMART Domains Protein: ENSMUSP00000124595
Gene: ENSMUSG00000029638

DomainStartEndE-ValueType
Pfam:FAM117 1 237 1e-83 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162206
Predicted Effect probably benign
Transcript: ENSMUST00000162564
Predicted Effect possibly damaging
Transcript: ENSMUST00000162567
AA Change: V298I

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125079
Gene: ENSMUSG00000029638
AA Change: V298I

DomainStartEndE-ValueType
Pfam:FAM117 1 285 2.7e-100 PFAM
low complexity region 306 319 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204813
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein of unknown function. Expression of this gene is induced by glucocorticoids and may be an early marker for glucocorticoid-induced apoptosis. Single nucleotide polymorphisms in this gene are associated with a decreased response to inhaled glucocorticoids in asthmatic patients. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,890 Y367* probably null Het
9930021J03Rik T C 19: 29,723,452 I745M probably benign Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arap3 T C 18: 37,981,973 R997G possibly damaging Het
Col22a1 T G 15: 71,837,377 K655T unknown Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
Gm9956 T A 10: 56,745,580 S113T probably damaging Het
Gpr75 T C 11: 30,892,706 I537T probably benign Het
Hars2 T G 18: 36,783,412 probably null Het
Helq A G 5: 100,796,464 V260A probably damaging Het
Ift172 A C 5: 31,280,976 F46V probably damaging Het
Klk1b9 A T 7: 43,978,424 I49L probably benign Het
Lrrk2 T G 15: 91,812,360 N2450K probably benign Het
Mtor T C 4: 148,470,307 V867A probably benign Het
Nlgn1 G T 3: 25,434,236 T645K possibly damaging Het
Nphs1 T C 7: 30,471,178 L931P probably damaging Het
Phf19 T C 2: 34,896,030 T476A probably benign Het
Rnf169 T C 7: 99,925,736 I551V probably benign Het
Ryr3 T A 2: 112,645,285 E4472V probably damaging Het
Tek T G 4: 94,804,830 F209V probably damaging Het
Vmn1r234 CTT CTTT 17: 21,229,251 probably null Het
Other mutations in Glcci1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Glcci1 APN 6 8579596 missense probably damaging 0.99
IGL02349:Glcci1 APN 6 8558581 missense probably damaging 1.00
IGL02877:Glcci1 APN 6 8582757 missense probably damaging 1.00
IGL03291:Glcci1 APN 6 8579678 missense probably damaging 1.00
R1084:Glcci1 UTSW 6 8573221 nonsense probably null
R1466:Glcci1 UTSW 6 8537964 missense probably damaging 1.00
R1466:Glcci1 UTSW 6 8537964 missense probably damaging 1.00
R1539:Glcci1 UTSW 6 8591620 missense probably damaging 1.00
R1584:Glcci1 UTSW 6 8537964 missense probably damaging 1.00
R1873:Glcci1 UTSW 6 8537837 missense probably benign 0.06
R1982:Glcci1 UTSW 6 8592980 missense probably damaging 1.00
R2043:Glcci1 UTSW 6 8582590 missense probably damaging 1.00
R2070:Glcci1 UTSW 6 8558566 missense probably damaging 1.00
R4834:Glcci1 UTSW 6 8582601 nonsense probably null
R5166:Glcci1 UTSW 6 8537854 missense probably benign 0.23
R5390:Glcci1 UTSW 6 8537835 missense probably benign 0.01
R6351:Glcci1 UTSW 6 8573203 nonsense probably null
X0065:Glcci1 UTSW 6 8591636 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTAGGTCTCGTCAGCCTATCTCGG -3'
(R):5'- TGGGAAAGTTTGTCACTCCATGCAG -3'

Sequencing Primer
(F):5'- AGCCTATCTCGGCCCCTC -3'
(R):5'- TGTCACTCCATGCAGATAGATG -3'
Posted On2014-01-29