Incidental Mutation 'R1289:Gm9956'
ID150737
Institutional Source Beutler Lab
Gene Symbol Gm9956
Ensembl Gene ENSMUSG00000054758
Gene Namepredicted gene 9956
Synonyms
MMRRC Submission 039355-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R1289 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location56745134-56748254 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56745580 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 113 (S113T)
Gene Model predicted gene model for transcript(s):
Predicted Effect probably damaging
Transcript: ENSMUST00000067972
AA Change: S113T

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071080
Gene: ENSMUSG00000054758
AA Change: S113T

DomainStartEndE-ValueType
transmembrane domain 94 116 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,890 Y367* probably null Het
9930021J03Rik T C 19: 29,723,452 I745M probably benign Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arap3 T C 18: 37,981,973 R997G possibly damaging Het
Col22a1 T G 15: 71,837,377 K655T unknown Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Glcci1 G A 6: 8,593,088 V298I possibly damaging Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
Gpr75 T C 11: 30,892,706 I537T probably benign Het
Hars2 T G 18: 36,783,412 probably null Het
Helq A G 5: 100,796,464 V260A probably damaging Het
Ift172 A C 5: 31,280,976 F46V probably damaging Het
Klk1b9 A T 7: 43,978,424 I49L probably benign Het
Lrrk2 T G 15: 91,812,360 N2450K probably benign Het
Mtor T C 4: 148,470,307 V867A probably benign Het
Nlgn1 G T 3: 25,434,236 T645K possibly damaging Het
Nphs1 T C 7: 30,471,178 L931P probably damaging Het
Phf19 T C 2: 34,896,030 T476A probably benign Het
Rnf169 T C 7: 99,925,736 I551V probably benign Het
Ryr3 T A 2: 112,645,285 E4472V probably damaging Het
Tek T G 4: 94,804,830 F209V probably damaging Het
Vmn1r234 CTT CTTT 17: 21,229,251 probably null Het
Other mutations in Gm9956
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01702:Gm9956 APN 10 56745239 start gained
IGL02411:Gm9956 APN 10 56745292 missense unknown
IGL02898:Gm9956 APN 10 56745254 missense unknown
R0513:Gm9956 UTSW 10 56745195 start gained
R0731:Gm9956 UTSW 10 56745543 nonsense probably null
R0841:Gm9956 UTSW 10 56745328 missense unknown
R0841:Gm9956 UTSW 10 56745329 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGTCATACCACAGTGCCCCTTTAC -3'
(R):5'- AAACACCTCAGCTTGGGAACTATCATC -3'

Sequencing Primer
(F):5'- GTAGTGCATAGAAGGTCCTCACTC -3'
(R):5'- GCGATAGTTCCATTGGATACAC -3'
Posted On2014-01-29