Incidental Mutation 'R1290:Mmp16'
ID150752
Institutional Source Beutler Lab
Gene Symbol Mmp16
Ensembl Gene ENSMUSG00000028226
Gene Namematrix metallopeptidase 16
SynonymsMT3-MMP, Membrane type 3-MMP
MMRRC Submission 039356-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1290 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location17852893-18119145 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18051725 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 238 (N238I)
Ref Sequence ENSEMBL: ENSMUSP00000029881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029881] [ENSMUST00000183662]
Predicted Effect probably damaging
Transcript: ENSMUST00000029881
AA Change: N238I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029881
Gene: ENSMUSG00000028226
AA Change: N238I

DomainStartEndE-ValueType
Pfam:PG_binding_1 38 96 3e-11 PFAM
ZnMc 123 292 1.62e-54 SMART
low complexity region 313 336 N/A INTRINSIC
HX 347 390 1.36e-7 SMART
HX 392 436 3.61e-12 SMART
HX 439 485 1.86e-14 SMART
HX 487 532 4.96e-10 SMART
Pfam:DUF3377 537 607 6.6e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139418
Predicted Effect probably damaging
Transcript: ENSMUST00000183662
AA Change: N238I

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139102
Gene: ENSMUSG00000028226
AA Change: N238I

DomainStartEndE-ValueType
Pfam:PG_binding_1 38 96 9.9e-12 PFAM
ZnMc 123 292 1.62e-54 SMART
low complexity region 313 336 N/A INTRINSIC
HX 347 390 1.36e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Mice lacking the encoded protein exhibit retarded growth of the skeleton, especially in the cranium and long bones. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a gene disruption display normal morphology, clinical chemistry, hematology, and behavior. Mice homozygous for a null allele exhibit reduced skeletal growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfrp1 C T 2: 181,364,604 probably null Het
Borcs5 A G 6: 134,644,368 D34G possibly damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Efl1 T C 7: 82,671,728 V123A probably damaging Het
Exd2 T A 12: 80,484,326 L99Q probably benign Het
Fnip2 T C 3: 79,465,693 D1026G probably damaging Het
Gprin3 A G 6: 59,354,464 F286S possibly damaging Het
Gramd1b A G 9: 40,316,821 probably null Het
Ints1 A T 5: 139,771,410 L417* probably null Het
Iqgap2 A T 13: 95,668,513 V845E probably damaging Het
Kcnh3 G A 15: 99,227,120 probably null Het
Mbd1 T C 18: 74,269,486 S20P possibly damaging Het
Mef2c A T 13: 83,662,359 T375S probably benign Het
Neurod2 A T 11: 98,327,288 V350E possibly damaging Het
P3h2 C T 16: 25,987,203 E297K probably damaging Het
Pcdhb1 A G 18: 37,265,230 H78R possibly damaging Het
Slc22a14 A C 9: 119,178,452 L297R probably damaging Het
Slc22a8 G A 19: 8,609,911 G445D probably damaging Het
Spink5 A G 18: 44,007,711 D659G probably damaging Het
St6gal1 A G 16: 23,321,661 Q194R probably benign Het
Tas2r104 A T 6: 131,684,845 C300* probably null Het
Ttc6 G A 12: 57,660,413 S702N probably benign Het
Wnk4 C G 11: 101,276,340 probably benign Het
Zfyve28 A T 5: 34,198,801 D785E probably benign Het
Other mutations in Mmp16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Mmp16 APN 4 18011784 missense probably benign 0.03
IGL01074:Mmp16 APN 4 18110584 splice site probably benign
IGL01125:Mmp16 APN 4 18112066 missense possibly damaging 0.95
IGL01309:Mmp16 APN 4 18116185 missense probably damaging 0.98
IGL01543:Mmp16 APN 4 18051743 missense probably damaging 1.00
IGL02036:Mmp16 APN 4 18093371 missense probably benign 0.00
IGL02252:Mmp16 APN 4 18110523 missense probably damaging 1.00
IGL03037:Mmp16 APN 4 17996222 missense probably damaging 0.98
R0483:Mmp16 UTSW 4 18115878 splice site probably benign
R0565:Mmp16 UTSW 4 17987705 missense probably damaging 1.00
R0885:Mmp16 UTSW 4 18054491 missense probably benign 0.12
R0966:Mmp16 UTSW 4 18115930 missense probably benign 0.31
R1158:Mmp16 UTSW 4 17987726 splice site probably null
R1326:Mmp16 UTSW 4 18054517 missense possibly damaging 0.61
R1345:Mmp16 UTSW 4 18112021 missense probably benign 0.01
R1424:Mmp16 UTSW 4 18112121 splice site probably null
R1610:Mmp16 UTSW 4 18011582 missense probably benign 0.00
R1722:Mmp16 UTSW 4 18051767 missense probably damaging 1.00
R1867:Mmp16 UTSW 4 18116013 missense probably benign 0.00
R2354:Mmp16 UTSW 4 18112001 missense probably damaging 1.00
R2431:Mmp16 UTSW 4 18054491 missense probably benign 0.12
R2992:Mmp16 UTSW 4 18011657 missense probably damaging 1.00
R5245:Mmp16 UTSW 4 18054596 intron probably benign
R5534:Mmp16 UTSW 4 18110452 missense probably damaging 0.99
R5941:Mmp16 UTSW 4 18054354 splice site probably benign
R5961:Mmp16 UTSW 4 17853842 missense probably benign 0.37
R6160:Mmp16 UTSW 4 18051857 missense probably damaging 1.00
R6514:Mmp16 UTSW 4 18116123 missense probably damaging 1.00
R6570:Mmp16 UTSW 4 18011501 missense possibly damaging 0.64
R6866:Mmp16 UTSW 4 17853800 missense probably benign 0.23
R7037:Mmp16 UTSW 4 18116148 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGTGAGAATTTGCAGTGTGAGACCAC -3'
(R):5'- TGCCACATAGGGTTTAGCAAACAGG -3'

Sequencing Primer
(F):5'- TCTAGGAGTCAGAATAACATGAGTCC -3'
(R):5'- GGAGTAGTGGAACCTACCATATATC -3'
Posted On2014-01-29