Mutagenetix > Incidental Mutation

Incidental Mutation 'R1290:Spink5'

150774

Institutional Source

Beutler Lab

Gene Symbol

Spink5

Ensembl Gene

ENSMUSG00000055561

Gene Name

serine peptidase inhibitor, Kazal type 5

Synonyms

LEKT1, 2310065D10Rik

MMRRC Submission

039356-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1290 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

44096302-44155568 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 44140778 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 659 (D659G)

Ref Sequence

ENSEMBL: ENSMUSP00000066214 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069245]

AlphaFold

Q148R4

Predicted Effect

probably damaging
Transcript: ENSMUST00000069245
AA Change: D659G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000066214
Gene: ENSMUSG00000055561
AA Change: D659G

Domain	Start	End	E-Value	Type
PDB:1UUC\|A	26	77	3e-6	PDB
KAZAL	97	152	1.67e-15	SMART
KAZAL	161	216	2.07e-3	SMART
KAZAL	226	281	3.37e-11	SMART
KAZAL	298	353	2.92e-6	SMART
KAZAL	367	424	6.73e-3	SMART
KAZAL	426	480	6.07e-4	SMART
KAZAL	496	558	2.43e-1	SMART
KAZAL	559	614	2.72e-15	SMART
KAZAL	633	687	1.95e-7	SMART
KAZAL	700	755	1.01e-9	SMART
KAZAL	769	824	7.29e-7	SMART
KAZAL	865	931	1.32e-4	SMART
KAZAL	942	996	2.74e-11	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain serine protease inhibitor that contains 15 potential inhibitory domains. The encoded preproprotein is proteolytically processed to generate multiple protein products, which may exhibit unique activities and specificities. These proteins may play a role in skin and hair morphogenesis, as well as anti-inflammatory and antimicrobial protection of mucous epithelia. Mutations in this gene may result in Netherton syndrome, a disorder characterized by ichthyosis, defective cornification, and atopy. This gene is present in a gene cluster on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutant mice display neonatal lethality, exfoliative erythroderma, and severe dehydration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 24 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arfrp1	C	T	2: 181,006,397 (GRCm39)		probably null	Het
Borcs5	A	G	6: 134,621,331 (GRCm39)	D34G	possibly damaging	Het
Dync1h1	G	A	12: 110,602,943 (GRCm39)	E2195K	probably benign	Het
Efl1	T	C	7: 82,320,936 (GRCm39)	V123A	probably damaging	Het
Exd2	T	A	12: 80,531,100 (GRCm39)	L99Q	probably benign	Het
Fnip2	T	C	3: 79,373,000 (GRCm39)	D1026G	probably damaging	Het
Gprin3	A	G	6: 59,331,449 (GRCm39)	F286S	possibly damaging	Het
Gramd1b	A	G	9: 40,228,117 (GRCm39)		probably null	Het
Ints1	A	T	5: 139,757,165 (GRCm39)	L417*	probably null	Het
Iqgap2	A	T	13: 95,805,021 (GRCm39)	V845E	probably damaging	Het
Kcnh3	G	A	15: 99,125,001 (GRCm39)		probably null	Het
Mbd1	T	C	18: 74,402,557 (GRCm39)	S20P	possibly damaging	Het
Mef2c	A	T	13: 83,810,478 (GRCm39)	T375S	probably benign	Het
Mmp16	A	T	4: 18,051,725 (GRCm39)	N238I	probably damaging	Het
Neurod2	A	T	11: 98,218,114 (GRCm39)	V350E	possibly damaging	Het
P3h2	C	T	16: 25,805,953 (GRCm39)	E297K	probably damaging	Het
Pcdhb1	A	G	18: 37,398,283 (GRCm39)	H78R	possibly damaging	Het
Slc22a14	A	C	9: 119,007,518 (GRCm39)	L297R	probably damaging	Het
Slc22a8	G	A	19: 8,587,275 (GRCm39)	G445D	probably damaging	Het
St6gal1	A	G	16: 23,140,411 (GRCm39)	Q194R	probably benign	Het
Tas2r104	A	T	6: 131,661,808 (GRCm39)	C300*	probably null	Het
Ttc6	G	A	12: 57,707,199 (GRCm39)	S702N	probably benign	Het
Wnk4	C	G	11: 101,167,166 (GRCm39)		probably benign	Het
Zfyve28	A	T	5: 34,356,145 (GRCm39)	D785E	probably benign	Het

Other mutations in Spink5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00226:Spink5	APN	18	44,120,938 (GRCm39)	splice site	probably benign
IGL00332:Spink5	APN	18	44,100,111 (GRCm39)	missense	probably benign	0.00
IGL00501:Spink5	APN	18	44,110,806 (GRCm39)	missense	probably damaging	0.98
IGL00772:Spink5	APN	18	44,139,487 (GRCm39)	missense	probably benign	0.02
IGL00920:Spink5	APN	18	44,136,276 (GRCm39)	missense	probably damaging	1.00
IGL00980:Spink5	APN	18	44,140,777 (GRCm39)	missense	probably damaging	1.00
IGL01016:Spink5	APN	18	44,140,711 (GRCm39)	missense	probably damaging	1.00
IGL01155:Spink5	APN	18	44,114,214 (GRCm39)	missense	probably benign	0.01
IGL01374:Spink5	APN	18	44,122,471 (GRCm39)	missense	possibly damaging	0.74
IGL01629:Spink5	APN	18	44,129,677 (GRCm39)	splice site	probably benign
IGL01907:Spink5	APN	18	44,129,743 (GRCm39)	missense	probably damaging	1.00
IGL01931:Spink5	APN	18	44,148,705 (GRCm39)	missense	probably benign	0.02
IGL02237:Spink5	APN	18	44,145,934 (GRCm39)	missense	probably benign	0.03
IGL02306:Spink5	APN	18	44,097,511 (GRCm39)	missense	probably damaging	0.98
IGL02402:Spink5	APN	18	44,100,171 (GRCm39)	missense	probably damaging	1.00
IGL02425:Spink5	APN	18	44,123,811 (GRCm39)	critical splice donor site	probably null
IGL02552:Spink5	APN	18	44,125,235 (GRCm39)	missense	possibly damaging	0.80
IGL02554:Spink5	APN	18	44,148,661 (GRCm39)	missense	probably benign	0.01
IGL03066:Spink5	APN	18	44,149,457 (GRCm39)	missense	probably damaging	1.00
IGL03288:Spink5	APN	18	44,147,827 (GRCm39)	missense	possibly damaging	0.59
crusty2	UTSW	18	44,133,001 (GRCm39)	splice site	probably benign
R0079:Spink5	UTSW	18	44,110,831 (GRCm39)	missense	probably damaging	1.00
R0184:Spink5	UTSW	18	44,136,265 (GRCm39)	missense	probably benign	0.00
R0452:Spink5	UTSW	18	44,096,385 (GRCm39)	missense	possibly damaging	0.74
R0569:Spink5	UTSW	18	44,122,486 (GRCm39)	missense	probably damaging	1.00
R0639:Spink5	UTSW	18	44,146,042 (GRCm39)	splice site	probably null
R0648:Spink5	UTSW	18	44,132,864 (GRCm39)	splice site	probably benign
R0705:Spink5	UTSW	18	44,125,341 (GRCm39)	missense	probably benign	0.01
R1170:Spink5	UTSW	18	44,116,630 (GRCm39)	missense	probably benign	0.07
R1345:Spink5	UTSW	18	44,123,749 (GRCm39)	missense	possibly damaging	0.88
R1458:Spink5	UTSW	18	44,140,786 (GRCm39)	missense	probably benign	0.01
R1530:Spink5	UTSW	18	44,148,738 (GRCm39)	missense	probably damaging	0.96
R1570:Spink5	UTSW	18	44,100,174 (GRCm39)	missense	probably benign	0.00
R1820:Spink5	UTSW	18	44,122,486 (GRCm39)	missense	possibly damaging	0.94
R1843:Spink5	UTSW	18	44,132,958 (GRCm39)	missense	probably benign	0.03
R1968:Spink5	UTSW	18	44,123,775 (GRCm39)	missense	probably benign	0.06
R2050:Spink5	UTSW	18	44,140,825 (GRCm39)	critical splice donor site	probably null
R2252:Spink5	UTSW	18	44,153,891 (GRCm39)	nonsense	probably null
R2278:Spink5	UTSW	18	44,119,396 (GRCm39)	missense	probably benign	0.07
R2279:Spink5	UTSW	18	44,119,396 (GRCm39)	missense	probably benign	0.07
R2696:Spink5	UTSW	18	44,115,359 (GRCm39)	missense	probably damaging	1.00
R2992:Spink5	UTSW	18	44,129,696 (GRCm39)	missense	probably damaging	1.00
R3422:Spink5	UTSW	18	44,143,311 (GRCm39)	missense	probably benign	0.01
R3934:Spink5	UTSW	18	44,149,494 (GRCm39)	missense	probably damaging	1.00
R4179:Spink5	UTSW	18	44,120,934 (GRCm39)	missense	probably benign
R4854:Spink5	UTSW	18	44,153,908 (GRCm39)	makesense	probably null
R5011:Spink5	UTSW	18	44,139,479 (GRCm39)	missense	probably damaging	0.97
R5133:Spink5	UTSW	18	44,119,490 (GRCm39)	missense	probably damaging	1.00
R5163:Spink5	UTSW	18	44,132,924 (GRCm39)	missense	possibly damaging	0.95
R5185:Spink5	UTSW	18	44,148,711 (GRCm39)	missense	probably damaging	0.97
R5187:Spink5	UTSW	18	44,122,518 (GRCm39)	missense	probably damaging	1.00
R5292:Spink5	UTSW	18	44,139,521 (GRCm39)	missense	probably benign
R5332:Spink5	UTSW	18	44,125,984 (GRCm39)	missense	possibly damaging	0.89
R5600:Spink5	UTSW	18	44,151,778 (GRCm39)	missense	probably damaging	0.96
R6267:Spink5	UTSW	18	44,147,824 (GRCm39)	missense	probably damaging	0.99
R6296:Spink5	UTSW	18	44,147,824 (GRCm39)	missense	probably damaging	0.99
R6373:Spink5	UTSW	18	44,123,739 (GRCm39)	missense	probably damaging	1.00
R6982:Spink5	UTSW	18	44,143,109 (GRCm39)	splice site	probably null
R6982:Spink5	UTSW	18	44,110,792 (GRCm39)	missense	probably damaging	1.00
R7332:Spink5	UTSW	18	44,115,317 (GRCm39)	missense	probably damaging	0.96
R7396:Spink5	UTSW	18	44,110,722 (GRCm39)	missense	possibly damaging	0.95
R7643:Spink5	UTSW	18	44,143,319 (GRCm39)	missense	probably benign	0.37
R7726:Spink5	UTSW	18	44,096,419 (GRCm39)	missense	probably damaging	1.00
R7828:Spink5	UTSW	18	44,143,296 (GRCm39)	missense	probably benign	0.15
R7836:Spink5	UTSW	18	44,132,888 (GRCm39)	missense	probably benign	0.00
R7880:Spink5	UTSW	18	44,119,393 (GRCm39)	missense	probably benign	0.40
R8031:Spink5	UTSW	18	44,143,303 (GRCm39)	missense	probably benign	0.07
R8198:Spink5	UTSW	18	44,125,947 (GRCm39)	missense	probably benign	0.17
R8361:Spink5	UTSW	18	44,122,529 (GRCm39)	missense	probably damaging	1.00
R8375:Spink5	UTSW	18	44,123,786 (GRCm39)	missense	probably benign	0.01
R8684:Spink5	UTSW	18	44,143,305 (GRCm39)	missense	probably benign	0.02
R8749:Spink5	UTSW	18	44,122,425 (GRCm39)	nonsense	probably null
R8918:Spink5	UTSW	18	44,100,087 (GRCm39)	missense	probably damaging	0.98
R9064:Spink5	UTSW	18	44,100,193 (GRCm39)	missense	probably damaging	1.00
R9161:Spink5	UTSW	18	44,147,986 (GRCm39)	missense	probably damaging	1.00
R9221:Spink5	UTSW	18	44,119,367 (GRCm39)	missense	probably damaging	1.00
R9292:Spink5	UTSW	18	44,148,075 (GRCm39)	missense	possibly damaging	0.91
R9545:Spink5	UTSW	18	44,136,262 (GRCm39)	missense	possibly damaging	0.88
R9784:Spink5	UTSW	18	44,119,490 (GRCm39)	missense	probably damaging	1.00
Z1177:Spink5	UTSW	18	44,129,764 (GRCm39)	missense	probably damaging	1.00
Z1177:Spink5	UTSW	18	44,129,702 (GRCm39)	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- CCCATTTCTCTGTGGACAGCAACC -3'
(R):5'- AGCTCTCTTAAACACTGGGCAGC -3'

Sequencing Primer
(F):5'- TGAAAGGAAAGTGTGTTTCTGATGC -3'
(R):5'- CTGGGCAGCTATTCCAAATG -3'

Posted On

2014-01-29