Incidental Mutation 'R1291:Bmp5'
ID150789
Institutional Source Beutler Lab
Gene Symbol Bmp5
Ensembl Gene ENSMUSG00000032179
Gene Namebone morphogenetic protein 5
Synonyms
MMRRC Submission 039357-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.543) question?
Stock #R1291 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location75775364-75900310 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 75886673 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 355 (K355*)
Ref Sequence ENSEMBL: ENSMUSP00000012281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012281]
Predicted Effect probably null
Transcript: ENSMUST00000012281
AA Change: K355*
SMART Domains Protein: ENSMUSP00000012281
Gene: ENSMUSG00000032179
AA Change: K355*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:TGFb_propeptide 31 304 5.2e-94 PFAM
low complexity region 316 331 N/A INTRINSIC
TGFB 353 454 3.54e-69 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer, which plays a role in bone and cartilage development. Mice with null mutations in this gene exhibit a short ear phenotype, which is characterized by reduced size of the external ear, altered size and shape of the sternum, and other skeletal and soft-tissue abnormalities. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous recessive mutants have shortened, slightly ruffled external ears due to a defective cartilage framework affecting the whole skeleton; a series of genomic deletions of the region cause embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 C A 5: 30,199,534 L301F probably damaging Het
Apba1 G T 19: 23,917,672 A491S probably damaging Het
C130060K24Rik T A 6: 65,452,900 Y193* probably null Het
C330021F23Rik T C 8: 3,583,938 I13T probably damaging Het
Chdh C T 14: 30,031,562 R143* probably null Het
Evc2 A G 5: 37,386,815 E636G probably damaging Het
Hmcn1 T A 1: 150,748,191 I1120F probably damaging Het
Lama4 A T 10: 39,048,069 H491L probably benign Het
Lrp1b A T 2: 41,341,895 S1074T probably benign Het
Nell1 T C 7: 50,230,250 V330A probably benign Het
Psg20 T C 7: 18,684,674 D56G possibly damaging Het
Ptk2 C T 15: 73,210,756 V951I probably damaging Het
Rtel1 A G 2: 181,351,043 D632G probably damaging Het
Smoc1 T C 12: 81,179,591 F397L probably damaging Het
Spsb3 G T 17: 24,887,808 probably null Het
Srp68 A T 11: 116,263,281 L154H probably damaging Het
Timp3 A G 10: 86,345,838 Y191C probably damaging Het
Vmn2r50 T C 7: 10,037,477 T766A probably damaging Het
Ythdc2 C T 18: 44,855,209 S28F probably benign Het
Ywhaz T C 15: 36,772,734 probably benign Het
Other mutations in Bmp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01643:Bmp5 APN 9 75839613 missense probably damaging 1.00
IGL02096:Bmp5 APN 9 75898551 missense probably damaging 1.00
IGL02977:Bmp5 APN 9 75893799 missense probably damaging 1.00
FR4976:Bmp5 UTSW 9 75776375 small deletion probably benign
R1679:Bmp5 UTSW 9 75839595 missense probably benign
R2049:Bmp5 UTSW 9 75893790 missense probably damaging 1.00
R2278:Bmp5 UTSW 9 75776548 missense possibly damaging 0.90
R5159:Bmp5 UTSW 9 75893753 missense probably damaging 1.00
R5431:Bmp5 UTSW 9 75893709 missense probably damaging 1.00
R5756:Bmp5 UTSW 9 75776367 missense probably benign
R5884:Bmp5 UTSW 9 75898554 missense probably damaging 1.00
R6749:Bmp5 UTSW 9 75776093 start codon destroyed probably benign 0.00
R7346:Bmp5 UTSW 9 75873360 missense probably damaging 1.00
R7522:Bmp5 UTSW 9 75776102 missense not run
Predicted Primers PCR Primer
(F):5'- TCAGTGAATGACAGCACCAGCC -3'
(R):5'- TCATCTGCAAATGCAAATGACTCATGC -3'

Sequencing Primer
(F):5'- CCAGCCTATGCCTGATGTATAAATG -3'
(R):5'- TCCCTAGATAGTTGTTAAACCCAACC -3'
Posted On2014-01-29