Incidental Mutation 'R1291:Chdh'
ID150795
Institutional Source Beutler Lab
Gene Symbol Chdh
Ensembl Gene ENSMUSG00000015970
Gene Namecholine dehydrogenase
SynonymsD630034H06Rik
MMRRC Submission 039357-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1291 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location30009023-30040527 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 30031562 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 143 (R143*)
Ref Sequence ENSEMBL: ENSMUSP00000112916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067620] [ENSMUST00000118917]
Predicted Effect probably null
Transcript: ENSMUST00000067620
AA Change: R143*
SMART Domains Protein: ENSMUSP00000065542
Gene: ENSMUSG00000015970
AA Change: R143*

DomainStartEndE-ValueType
Pfam:GMC_oxred_N 43 341 2.4e-98 PFAM
Pfam:Lycopene_cycl 45 110 8.4e-8 PFAM
Pfam:GMC_oxred_C 431 569 2.5e-43 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000118917
AA Change: R143*
SMART Domains Protein: ENSMUSP00000112916
Gene: ENSMUSG00000015970
AA Change: R143*

DomainStartEndE-ValueType
Pfam:GMC_oxred_N 43 341 2.4e-98 PFAM
Pfam:Lycopene_cycl 44 109 1.9e-8 PFAM
Pfam:GMC_oxred_C 431 569 5.9e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225370
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a choline dehydrogenase that localizes to the mitochondrion. Variations in this gene can affect susceptibility to choline deficiency. A few transcript variants have been found for this gene, but the full-length nature of only one has been characterized to date. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous male mutants show reduced fertility due to reduced sperm motility caused by abnormal mitochondrial function and structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 C A 5: 30,199,534 L301F probably damaging Het
Apba1 G T 19: 23,917,672 A491S probably damaging Het
Bmp5 A T 9: 75,886,673 K355* probably null Het
C130060K24Rik T A 6: 65,452,900 Y193* probably null Het
C330021F23Rik T C 8: 3,583,938 I13T probably damaging Het
Evc2 A G 5: 37,386,815 E636G probably damaging Het
Hmcn1 T A 1: 150,748,191 I1120F probably damaging Het
Lama4 A T 10: 39,048,069 H491L probably benign Het
Lrp1b A T 2: 41,341,895 S1074T probably benign Het
Nell1 T C 7: 50,230,250 V330A probably benign Het
Psg20 T C 7: 18,684,674 D56G possibly damaging Het
Ptk2 C T 15: 73,210,756 V951I probably damaging Het
Rtel1 A G 2: 181,351,043 D632G probably damaging Het
Smoc1 T C 12: 81,179,591 F397L probably damaging Het
Spsb3 G T 17: 24,887,808 probably null Het
Srp68 A T 11: 116,263,281 L154H probably damaging Het
Timp3 A G 10: 86,345,838 Y191C probably damaging Het
Vmn2r50 T C 7: 10,037,477 T766A probably damaging Het
Ythdc2 C T 18: 44,855,209 S28F probably benign Het
Ywhaz T C 15: 36,772,734 probably benign Het
Other mutations in Chdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Chdh APN 14 30031332 missense probably benign 0.15
IGL01309:Chdh APN 14 30035804 unclassified probably benign
IGL01515:Chdh APN 14 30036886 missense probably damaging 1.00
IGL01828:Chdh APN 14 30036608 missense probably damaging 0.96
IGL01953:Chdh APN 14 30035347 missense probably benign 0.24
IGL01989:Chdh APN 14 30031731 missense possibly damaging 0.71
IGL02325:Chdh APN 14 30032825 missense probably benign 0.01
IGL02620:Chdh APN 14 30031139 missense probably damaging 0.99
IGL03180:Chdh APN 14 30034602 splice site probably null
R0024:Chdh UTSW 14 30031596 missense possibly damaging 0.81
R0455:Chdh UTSW 14 30034646 missense probably damaging 1.00
R0486:Chdh UTSW 14 30032858 missense possibly damaging 0.83
R0668:Chdh UTSW 14 30035880 missense probably damaging 1.00
R0684:Chdh UTSW 14 30031613 missense probably damaging 1.00
R0971:Chdh UTSW 14 30033663 missense probably damaging 1.00
R1381:Chdh UTSW 14 30036834 missense probably damaging 1.00
R1386:Chdh UTSW 14 30031434 missense probably damaging 1.00
R1412:Chdh UTSW 14 30034723 missense probably benign 0.01
R1912:Chdh UTSW 14 30032788 missense probably benign 0.00
R2198:Chdh UTSW 14 30031532 missense possibly damaging 0.91
R4077:Chdh UTSW 14 30035340 missense probably damaging 0.99
R4412:Chdh UTSW 14 30031715 missense probably damaging 1.00
R4713:Chdh UTSW 14 30036841 missense probably benign 0.28
R4865:Chdh UTSW 14 30033724 missense probably benign 0.00
R4940:Chdh UTSW 14 30032852 missense possibly damaging 0.82
R5207:Chdh UTSW 14 30031361 missense probably damaging 1.00
R5582:Chdh UTSW 14 30036859 missense probably damaging 1.00
R5710:Chdh UTSW 14 30034627 missense probably damaging 1.00
R5954:Chdh UTSW 14 30031181 missense possibly damaging 0.87
R6245:Chdh UTSW 14 30035305 missense probably damaging 0.99
R7032:Chdh UTSW 14 30036852 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TTCAGTGGAAGATCCACATGCCG -3'
(R):5'- ATGTCTTCAGTGAAGGGGTAGCCAG -3'

Sequencing Primer
(F):5'- GTGTCCAACCTGTGTGATGA -3'
(R):5'- GTAGCCAGCCTGACGTG -3'
Posted On2014-01-29