Incidental Mutation 'R1291:Apba1'
ID150801
Institutional Source Beutler Lab
Gene Symbol Apba1
Ensembl Gene ENSMUSG00000024897
Gene Nameamyloid beta (A4) precursor protein binding, family A, member 1
Synonyms6430513E09Rik, Lin-10, X11, Mint, Mint1, X11alpha
MMRRC Submission 039357-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1291 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location23758876-23949597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 23917672 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 491 (A491S)
Ref Sequence ENSEMBL: ENSMUSP00000025830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025830]
Predicted Effect probably damaging
Transcript: ENSMUST00000025830
AA Change: A491S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025830
Gene: ENSMUSG00000024897
AA Change: A491S

DomainStartEndE-ValueType
low complexity region 40 47 N/A INTRINSIC
low complexity region 59 74 N/A INTRINSIC
low complexity region 129 149 N/A INTRINSIC
low complexity region 404 421 N/A INTRINSIC
PTB 461 626 9.49e-33 SMART
PDZ 670 748 3.09e-15 SMART
PDZ 762 828 2.53e-11 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the X11 protein family. It is a neuronal adapter protein that interacts with the Alzheimer's disease amyloid precursor protein (APP). It stabilizes APP and inhibits production of proteolytic APP fragments including the A beta peptide that is deposited in the brains of Alzheimer's disease patients. This gene product is believed to be involved in signal transduction processes. It is also regarded as a putative vesicular trafficking protein in the brain that can form a complex with the potential to couple synaptic vesicle exocytosis to neuronal cell adhesion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals carrying a homozygous mutation of this gene have reduced body size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 C A 5: 30,199,534 L301F probably damaging Het
Bmp5 A T 9: 75,886,673 K355* probably null Het
C130060K24Rik T A 6: 65,452,900 Y193* probably null Het
C330021F23Rik T C 8: 3,583,938 I13T probably damaging Het
Chdh C T 14: 30,031,562 R143* probably null Het
Evc2 A G 5: 37,386,815 E636G probably damaging Het
Hmcn1 T A 1: 150,748,191 I1120F probably damaging Het
Lama4 A T 10: 39,048,069 H491L probably benign Het
Lrp1b A T 2: 41,341,895 S1074T probably benign Het
Nell1 T C 7: 50,230,250 V330A probably benign Het
Psg20 T C 7: 18,684,674 D56G possibly damaging Het
Ptk2 C T 15: 73,210,756 V951I probably damaging Het
Rtel1 A G 2: 181,351,043 D632G probably damaging Het
Smoc1 T C 12: 81,179,591 F397L probably damaging Het
Spsb3 G T 17: 24,887,808 probably null Het
Srp68 A T 11: 116,263,281 L154H probably damaging Het
Timp3 A G 10: 86,345,838 Y191C probably damaging Het
Vmn2r50 T C 7: 10,037,477 T766A probably damaging Het
Ythdc2 C T 18: 44,855,209 S28F probably benign Het
Ywhaz T C 15: 36,772,734 probably benign Het
Other mutations in Apba1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Apba1 APN 19 23917586 missense possibly damaging 0.95
IGL01991:Apba1 APN 19 23937472 missense possibly damaging 0.80
IGL02048:Apba1 APN 19 23937636 splice site probably null
IGL02522:Apba1 APN 19 23912445 splice site probably benign
IGL02728:Apba1 APN 19 23944905 missense possibly damaging 0.93
IGL02942:Apba1 APN 19 23944971 missense possibly damaging 0.78
IGL03349:Apba1 APN 19 23917575 missense probably benign 0.02
IGL03410:Apba1 APN 19 23937581 missense possibly damaging 0.67
R0052:Apba1 UTSW 19 23915951 missense possibly damaging 0.90
R0052:Apba1 UTSW 19 23915951 missense possibly damaging 0.90
R0084:Apba1 UTSW 19 23912497 missense possibly damaging 0.68
R0379:Apba1 UTSW 19 23934830 missense probably damaging 1.00
R0423:Apba1 UTSW 19 23944998 missense probably damaging 1.00
R1132:Apba1 UTSW 19 23917553 missense possibly damaging 0.83
R1681:Apba1 UTSW 19 23936561 missense probably damaging 1.00
R1714:Apba1 UTSW 19 23944952 missense possibly damaging 0.67
R1756:Apba1 UTSW 19 23893692 missense possibly damaging 0.83
R1866:Apba1 UTSW 19 23892831 missense probably benign 0.22
R2076:Apba1 UTSW 19 23893223 nonsense probably null
R2217:Apba1 UTSW 19 23893962 missense probably damaging 0.99
R3907:Apba1 UTSW 19 23937506 missense probably damaging 0.96
R4095:Apba1 UTSW 19 23944024 missense probably benign 0.00
R4529:Apba1 UTSW 19 23936535 missense probably damaging 1.00
R4557:Apba1 UTSW 19 23917592 missense probably damaging 1.00
R4972:Apba1 UTSW 19 23912536 missense probably benign 0.24
R5521:Apba1 UTSW 19 23893593 missense probably damaging 1.00
R6539:Apba1 UTSW 19 23936560 missense probably damaging 1.00
R7032:Apba1 UTSW 19 23912461 missense probably benign 0.20
R7035:Apba1 UTSW 19 23917567 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GCCTCCCAAGCAACTAGGATTACAG -3'
(R):5'- GCTGGAACTGCACCTTAAAGGCAC -3'

Sequencing Primer
(F):5'- ggtctggctaagagacatttttttac -3'
(R):5'- TGCACCTTAAAGGCACTTAGAG -3'
Posted On2014-01-29