Incidental Mutation 'R1292:Slc2a2'
ID150806
Institutional Source Beutler Lab
Gene Symbol Slc2a2
Ensembl Gene ENSMUSG00000027690
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 2
SynonymsGlut2, liver-type glucose transporter, Glut-2
MMRRC Submission 039358-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1292 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location28697903-28731359 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 28717488 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 189 (T189I)
Ref Sequence ENSEMBL: ENSMUSP00000029240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029240] [ENSMUST00000163536]
Predicted Effect probably damaging
Transcript: ENSMUST00000029240
AA Change: T189I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029240
Gene: ENSMUSG00000027690
AA Change: T189I

DomainStartEndE-ValueType
Pfam:MFS_1 9 442 4.2e-23 PFAM
Pfam:Sugar_tr 13 498 2.4e-165 PFAM
Pfam:Folate_carrier 187 458 5.3e-12 PFAM
Predicted Effect silent
Transcript: ENSMUST00000163536
SMART Domains Protein: ENSMUSP00000131046
Gene: ENSMUSG00000027690

DomainStartEndE-ValueType
Pfam:Sugar_tr 13 133 3.9e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169047
Meta Mutation Damage Score 0.114 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral plasma membrane glycoprotein of the liver, islet beta cells, intestine, and kidney epithelium. The encoded protein mediates facilitated bidirectional glucose transport. Because of its low affinity for glucose, it has been suggested as a glucose sensor. Mutations in this gene are associated with susceptibility to diseases, including Fanconi-Bickel syndrome and noninsulin-dependent diabetes mellitus (NIDDM). Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous null mice are hyperglycemic with hypoinsulinemia and die within 2-3 weeks of life displaying increased plasma levels of glucagon, free fatty acids and beta-hydroxybutyrate, abnormal glucose tolerance, and altered postnatal development of pancreatic islets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik T A 9: 53,425,619 D74E probably benign Het
9530053A07Rik A C 7: 28,142,794 probably benign Het
Abcb1a A T 5: 8,713,343 T624S probably benign Het
Atp8b1 T C 18: 64,571,021 Y342C probably damaging Het
Clcnka A G 4: 141,395,592 probably benign Het
Cma2 C T 14: 55,973,742 R164C probably damaging Het
Cnga1 T C 5: 72,604,683 D496G probably damaging Het
Ctbp2 T A 7: 133,015,189 R6W probably damaging Het
Cyp3a11 T C 5: 145,865,994 T230A probably benign Het
Defb40 A C 8: 18,978,064 I18S probably benign Het
Gm10036 T G 18: 15,833,311 I173S possibly damaging Het
Herc2 A T 7: 56,197,203 I3634L probably benign Het
Igfbp1 A G 11: 7,200,863 N218S probably damaging Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Kmt2a A T 9: 44,814,694 probably benign Het
Ly9 T C 1: 171,589,103 probably null Het
Mut C A 17: 40,941,407 A280E probably damaging Het
Olfr180 C T 16: 58,915,771 R290K probably damaging Het
Olfr231 A G 1: 174,117,854 F54S probably benign Het
Pcdhb13 T C 18: 37,443,832 V421A probably benign Het
Pik3ca T A 3: 32,454,420 L779Q probably damaging Het
Plxnd1 T C 6: 115,962,683 probably benign Het
Prss16 T A 13: 22,009,521 K35* probably null Het
Rhbdl2 G A 4: 123,829,642 A280T possibly damaging Het
Srsf6 C T 2: 162,934,483 probably benign Het
Tacr1 A G 6: 82,554,875 I251V probably damaging Het
Tln1 A G 4: 43,534,578 probably null Het
Vdac3-ps1 T C 13: 18,031,295 noncoding transcript Het
Zfp458 A T 13: 67,256,690 C562S probably damaging Het
Other mutations in Slc2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Slc2a2 APN 3 28718741 missense possibly damaging 0.86
IGL01582:Slc2a2 APN 3 28708488 missense probably benign 0.01
IGL01762:Slc2a2 APN 3 28717472 missense probably damaging 1.00
IGL01942:Slc2a2 APN 3 28705803 missense probably damaging 1.00
IGL02128:Slc2a2 APN 3 28719401 missense probably damaging 1.00
IGL02218:Slc2a2 APN 3 28698025 missense possibly damaging 0.94
IGL02278:Slc2a2 APN 3 28717455 missense probably damaging 0.99
IGL02507:Slc2a2 APN 3 28727111 missense probably benign 0.00
IGL02649:Slc2a2 APN 3 28718736 missense probably damaging 0.97
IGL03323:Slc2a2 APN 3 28726290 missense probably damaging 1.00
IGL03147:Slc2a2 UTSW 3 28719370 missense possibly damaging 0.56
R0063:Slc2a2 UTSW 3 28717440 missense probably damaging 0.98
R0063:Slc2a2 UTSW 3 28717440 missense probably damaging 0.98
R0365:Slc2a2 UTSW 3 28708679 critical splice donor site probably null
R0494:Slc2a2 UTSW 3 28727277 missense probably benign 0.01
R0519:Slc2a2 UTSW 3 28718816 missense possibly damaging 0.54
R1755:Slc2a2 UTSW 3 28713662 intron probably null
R1965:Slc2a2 UTSW 3 28719485 missense probably damaging 1.00
R1966:Slc2a2 UTSW 3 28719485 missense probably damaging 1.00
R1982:Slc2a2 UTSW 3 28717441 missense probably benign 0.36
R2937:Slc2a2 UTSW 3 28718771 missense probably damaging 1.00
R3121:Slc2a2 UTSW 3 28721749 missense probably benign 0.01
R3721:Slc2a2 UTSW 3 28727152 missense probably damaging 1.00
R4799:Slc2a2 UTSW 3 28717532 critical splice donor site probably null
R5206:Slc2a2 UTSW 3 28708607 missense probably damaging 1.00
R6829:Slc2a2 UTSW 3 28727441 nonsense probably null
R6864:Slc2a2 UTSW 3 28721725 missense probably damaging 1.00
R6932:Slc2a2 UTSW 3 28717519 missense probably benign 0.40
R7178:Slc2a2 UTSW 3 28719482 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ATGCCCATGTTTGGGGACAAGG -3'
(R):5'- TCGTATTGCCAATCCCACCAGC -3'

Sequencing Primer
(F):5'- GGGGACATCTGAAGTATGACTTTC -3'
(R):5'- TGGAAATAAGTCACCTCTGAGC -3'
Posted On2014-01-29