Incidental Mutation 'R1292:4930550C14Rik'
ID150821
Institutional Source Beutler Lab
Gene Symbol 4930550C14Rik
Ensembl Gene ENSMUSG00000005131
Gene NameRIKEN cDNA 4930550C14 gene
Synonyms
MMRRC Submission 039358-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R1292 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location53402325-53434402 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 53425619 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 74 (D74E)
Ref Sequence ENSEMBL: ENSMUSP00000149814 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000005262
AA Change: D219E

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000215668
AA Change: D74E

PolyPhen 2 Score 0.203 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000217318
AA Change: D74E

PolyPhen 2 Score 0.203 (Sensitivity: 0.92; Specificity: 0.88)
Meta Mutation Damage Score 0.02 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 97% (31/32)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A C 7: 28,142,794 probably benign Het
Abcb1a A T 5: 8,713,343 T624S probably benign Het
Atp8b1 T C 18: 64,571,021 Y342C probably damaging Het
Clcnka A G 4: 141,395,592 probably benign Het
Cma2 C T 14: 55,973,742 R164C probably damaging Het
Cnga1 T C 5: 72,604,683 D496G probably damaging Het
Ctbp2 T A 7: 133,015,189 R6W probably damaging Het
Cyp3a11 T C 5: 145,865,994 T230A probably benign Het
Defb40 A C 8: 18,978,064 I18S probably benign Het
Gm10036 T G 18: 15,833,311 I173S possibly damaging Het
Herc2 A T 7: 56,197,203 I3634L probably benign Het
Igfbp1 A G 11: 7,200,863 N218S probably damaging Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Kmt2a A T 9: 44,814,694 probably benign Het
Ly9 T C 1: 171,589,103 probably null Het
Mut C A 17: 40,941,407 A280E probably damaging Het
Olfr180 C T 16: 58,915,771 R290K probably damaging Het
Olfr231 A G 1: 174,117,854 F54S probably benign Het
Pcdhb13 T C 18: 37,443,832 V421A probably benign Het
Pik3ca T A 3: 32,454,420 L779Q probably damaging Het
Plxnd1 T C 6: 115,962,683 probably benign Het
Prss16 T A 13: 22,009,521 K35* probably null Het
Rhbdl2 G A 4: 123,829,642 A280T possibly damaging Het
Slc2a2 C T 3: 28,717,488 T189I probably damaging Het
Srsf6 C T 2: 162,934,483 probably benign Het
Tacr1 A G 6: 82,554,875 I251V probably damaging Het
Tln1 A G 4: 43,534,578 probably null Het
Vdac3-ps1 T C 13: 18,031,295 noncoding transcript Het
Zfp458 A T 13: 67,256,690 C562S probably damaging Het
Other mutations in 4930550C14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0310:4930550C14Rik UTSW 9 53425671 missense probably damaging 1.00
R0625:4930550C14Rik UTSW 9 53408065 missense probably benign
R1104:4930550C14Rik UTSW 9 53421617 missense probably benign 0.28
R2182:4930550C14Rik UTSW 9 53422943 missense probably damaging 1.00
R3924:4930550C14Rik UTSW 9 53432405 missense probably benign
R4756:4930550C14Rik UTSW 9 53425530 missense probably benign
R4757:4930550C14Rik UTSW 9 53425530 missense probably benign
R4834:4930550C14Rik UTSW 9 53432487 missense possibly damaging 0.78
R5244:4930550C14Rik UTSW 9 53411798 missense probably damaging 1.00
R6151:4930550C14Rik UTSW 9 53414383 missense probably damaging 1.00
R6353:4930550C14Rik UTSW 9 53414342 missense probably benign 0.00
R6376:4930550C14Rik UTSW 9 53428156 missense probably damaging 0.98
R6988:4930550C14Rik UTSW 9 53411756 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TGTGGATAAACAGACCTCCTCTCCC -3'
(R):5'- GGCTATGTTCATAACCCCAAGGTTCAA -3'

Sequencing Primer
(F):5'- tgggaggcagaggcagg -3'
(R):5'- GTGTGTTTGTCCAGTTCAGC -3'
Posted On2014-01-29