Incidental Mutation 'R1275:1110034G24Rik'
ID150857
Institutional Source Beutler Lab
Gene Symbol 1110034G24Rik
Ensembl Gene ENSMUSG00000044991
Gene NameRIKEN cDNA 1110034G24 gene
Synonyms
MMRRC Submission 039341-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R1275 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location132686931-132751055 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132692095 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 48 (S48P)
Ref Sequence ENSEMBL: ENSMUSP00000118968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061891] [ENSMUST00000110132] [ENSMUST00000148271]
Predicted Effect probably benign
Transcript: ENSMUST00000061891
AA Change: S48P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000057009
Gene: ENSMUSG00000044991
AA Change: S48P

DomainStartEndE-ValueType
Pfam:DUF4521 1 206 2.3e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110132
AA Change: S48P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105759
Gene: ENSMUSG00000044991
AA Change: S48P

DomainStartEndE-ValueType
Pfam:DUF4521 1 204 3.4e-100 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147868
Predicted Effect probably benign
Transcript: ENSMUST00000148271
AA Change: S48P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118968
Gene: ENSMUSG00000044991
AA Change: S48P

DomainStartEndE-ValueType
Pfam:DUF4521 1 156 6e-80 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,118 E315G probably benign Het
Clstn2 C T 9: 97,457,430 V793I probably benign Het
Coro1a C T 7: 126,700,583 probably null Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Efcab14 T G 4: 115,756,473 L206R probably damaging Het
Ehmt1 A G 2: 24,886,995 probably null Het
Fosl2 C T 5: 32,150,454 R130W probably damaging Het
Gfral A G 9: 76,197,032 C233R probably damaging Het
Gm281 T C 14: 13,896,949 Y142C probably damaging Het
Ino80 T C 2: 119,427,055 T765A probably benign Het
Mindy3 A T 2: 12,396,173 probably null Het
Myo15b CGGAGGAGGAGGAGGAGGAG CGGAGGAGGAGGAGGAG 11: 115,883,492 probably benign Het
Osbpl11 T A 16: 33,185,850 M16K probably benign Het
Rassf7 T A 7: 141,217,147 L91Q probably damaging Het
Unc13b A G 4: 43,235,366 K3318R probably damaging Het
Vmn1r234 CTT CTTT 17: 21,229,251 probably null Het
Zfp930 A G 8: 69,227,979 K108E possibly damaging Het
Other mutations in 1110034G24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02207:1110034G24Rik APN 2 132691946 splice site probably benign
R0243:1110034G24Rik UTSW 2 132750639 missense probably benign 0.01
R2518:1110034G24Rik UTSW 2 132750527 missense probably damaging 0.99
R6903:1110034G24Rik UTSW 2 132750644 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTCTCACAACGAAGGGAACTTGG -3'
(R):5'- AATGACCACATGTCTGTGCCTCTG -3'

Sequencing Primer
(F):5'- TGGTAGCTCCTACTCCACAGAC -3'
(R):5'- gggagggagggagggag -3'
Posted On2014-01-29