Incidental Mutation 'R1280:Fez1'
ID151005
Institutional Source Beutler Lab
Gene Symbol Fez1
Ensembl Gene ENSMUSG00000032118
Gene Namefasciculation and elongation protein zeta 1 (zygin I)
SynonymsUNC-76, UNC76
MMRRC Submission 039346-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1280 (G1)
Quality Score138
Status Not validated
Chromosome9
Chromosomal Location36821864-36878924 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GACAAACA to GACA at 36870549 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034630] [ENSMUST00000162235] [ENSMUST00000163816]
Predicted Effect probably null
Transcript: ENSMUST00000034630
SMART Domains Protein: ENSMUSP00000034630
Gene: ENSMUSG00000032118

DomainStartEndE-ValueType
Pfam:FEZ 58 300 3.4e-96 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159137
Predicted Effect probably benign
Transcript: ENSMUST00000160041
SMART Domains Protein: ENSMUSP00000124648
Gene: ENSMUSG00000032118

DomainStartEndE-ValueType
Pfam:FEZ 35 87 4.6e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000161978
Predicted Effect probably null
Transcript: ENSMUST00000162235
Predicted Effect probably null
Transcript: ENSMUST00000163816
SMART Domains Protein: ENSMUSP00000126072
Gene: ENSMUSG00000032118

DomainStartEndE-ValueType
Pfam:FEZ 58 297 2.7e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216539
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an ortholog of the C. elegans unc-76 gene, which is necessary for normal axonal bundling and elongation within axon bundles. Expression of this gene in C. elegans unc-76 mutants can restore to the mutants partial locomotion and axonal fasciculation, suggesting that it also functions in axonal outgrowth. The N-terminal half of the gene product is highly acidic. Alternatively spliced transcript variants encoding different isoforms of this protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit hyperactivity and increased sensitivity to methamphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Atp5g3 G T 2: 73,909,370 T42K possibly damaging Het
Brd2 T C 17: 34,114,150 M60V possibly damaging Het
Cabp1 T C 5: 115,175,471 N226S probably benign Het
Cers6 G A 2: 69,068,689 V224I probably benign Het
Entpd2 C T 2: 25,399,484 S326F probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Klhdc7a G A 4: 139,965,453 R728C probably benign Het
Myo18b A G 5: 112,723,805 probably null Het
Mzf1 A T 7: 13,053,083 L20Q probably damaging Het
Neil1 T C 9: 57,146,901 Y45C probably damaging Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Rbm12 T C 2: 156,096,829 K508E probably damaging Het
Socs4 A T 14: 47,290,913 Q435L probably benign Het
Tdrd9 T C 12: 112,039,408 V905A probably damaging Het
Tekt4 T A 17: 25,471,887 W56R probably damaging Het
Ttn A T 2: 76,778,164 I16059N possibly damaging Het
Ubqln3 A G 7: 104,142,076 V269A possibly damaging Het
Vps54 T A 11: 21,277,868 I273N possibly damaging Het
Zfp831 A G 2: 174,704,059 K1319R probably benign Het
Other mutations in Fez1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02540:Fez1 APN 9 36850399 missense probably damaging 0.97
R1458:Fez1 UTSW 9 36870549 frame shift probably null
R1741:Fez1 UTSW 9 36843733 missense probably damaging 1.00
R1846:Fez1 UTSW 9 36867767 missense probably damaging 1.00
R2072:Fez1 UTSW 9 36867945 missense probably benign 0.00
R4193:Fez1 UTSW 9 36843727 missense probably damaging 1.00
R4214:Fez1 UTSW 9 36870488 missense probably damaging 0.99
R4417:Fez1 UTSW 9 36870472 splice site probably benign
R4696:Fez1 UTSW 9 36870470 splice site probably null
R4735:Fez1 UTSW 9 36860845 nonsense probably null
R4947:Fez1 UTSW 9 36868875 missense probably damaging 0.99
R4950:Fez1 UTSW 9 36867882 missense probably damaging 1.00
R5538:Fez1 UTSW 9 36868876 missense probably damaging 1.00
R5618:Fez1 UTSW 9 36843932 missense probably damaging 1.00
R5742:Fez1 UTSW 9 36850447 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTGCCCCAGCTATCATTCAGGAG -3'
(R):5'- TCTTGCCCCATGCAAAGCCATC -3'

Sequencing Primer
(F):5'- GTTTCCCCCATTGATACAGGAAAG -3'
(R):5'- GCCATCCTAAAGAAATCTGGAAACTG -3'
Posted On2014-01-29