Incidental Mutation 'R1282:2810474O19Rik'
ID151056
Institutional Source Beutler Lab
Gene Symbol 2810474O19Rik
Ensembl Gene ENSMUSG00000032712
Gene NameRIKEN cDNA 2810474O19 gene
SynonymsGET
MMRRC Submission 039348-MU
Accession Numbers

Genbank: NM_026054; MGI: 1914496

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1282 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location149309414-149335663 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 149329172 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 1239 (Q1239*)
Ref Sequence ENSEMBL: ENSMUSP00000140026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046689] [ENSMUST00000100765] [ENSMUST00000127680] [ENSMUST00000130664] [ENSMUST00000185930] [ENSMUST00000187881] [ENSMUST00000189837] [ENSMUST00000189932] [ENSMUST00000190785]
Predicted Effect probably null
Transcript: ENSMUST00000046689
AA Change: Q1239*
SMART Domains Protein: ENSMUSP00000041180
Gene: ENSMUSG00000032712
AA Change: Q1239*

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000100765
AA Change: Q1239*
SMART Domains Protein: ENSMUSP00000098328
Gene: ENSMUSG00000032712
AA Change: Q1239*

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127680
Predicted Effect probably benign
Transcript: ENSMUST00000130664
Predicted Effect probably benign
Transcript: ENSMUST00000185930
Predicted Effect probably benign
Transcript: ENSMUST00000187881
Predicted Effect probably null
Transcript: ENSMUST00000189837
AA Change: Q1239*
SMART Domains Protein: ENSMUSP00000139660
Gene: ENSMUSG00000032712
AA Change: Q1239*

DomainStartEndE-ValueType
Pfam:DUF4617 451 1511 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000189932
AA Change: Q1239*
SMART Domains Protein: ENSMUSP00000140026
Gene: ENSMUSG00000032712
AA Change: Q1239*

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190785
SMART Domains Protein: ENSMUSP00000139624
Gene: ENSMUSG00000032712

DomainStartEndE-ValueType
Pfam:DUF4617 451 1173 9.4e-255 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI

All alleles(126) : Targeted, knock-out(1) Gene trapped(125)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd T C 1: 127,738,560 Y23H probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Atp2a2 G T 5: 122,491,754 T84K probably benign Het
Cfap65 T A 1: 74,925,104 T562S probably benign Het
Cyp2b10 G A 7: 25,926,080 C436Y probably damaging Het
Dnajc7 T C 11: 100,584,641 D381G probably damaging Het
Dnase1l3 T C 14: 7,983,117 D129G probably benign Het
Espl1 A G 15: 102,315,391 T1126A probably benign Het
Exoc3 T C 13: 74,182,292 N506S probably benign Het
Fastkd3 C A 13: 68,584,557 N332K possibly damaging Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Foxp4 G A 17: 47,875,643 P404S unknown Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm12789 T A 4: 101,988,290 W59R probably damaging Het
Greb1l T A 18: 10,547,289 N1502K probably benign Het
H2-K1 A C 17: 33,999,447 I165S probably damaging Het
Ipo9 A G 1: 135,402,292 I470T possibly damaging Het
Kcnu1 A T 8: 25,905,957 I657F probably benign Het
Lrp1b A T 2: 40,860,761 N2930K probably damaging Het
Olfr683 T A 7: 105,143,652 I220F probably benign Het
Prag1 T C 8: 36,099,914 V73A probably damaging Het
Prrc2b T C 2: 32,223,444 I1963T probably damaging Het
Rep15 C T 6: 147,033,229 R189* probably null Het
Rtp3 T C 9: 110,986,920 K188E probably benign Het
Scd2 T C 19: 44,295,181 L101P probably damaging Het
Scn7a A T 2: 66,700,849 H561Q probably damaging Het
Sfr1 T C 19: 47,732,968 S118P probably damaging Het
Slf1 C T 13: 77,043,840 M958I probably damaging Het
Snrk G T 9: 122,160,520 R310L possibly damaging Het
Snx11 T C 11: 96,773,161 Y35C probably damaging Het
Supt6 T C 11: 78,228,768 T404A possibly damaging Het
Svep1 C A 4: 58,100,032 L1337F possibly damaging Het
Traf3ip2 C T 10: 39,626,405 T183M probably damaging Het
Vmn2r28 A T 7: 5,481,302 M633K probably damaging Het
Vmn2r67 A G 7: 85,136,724 V691A probably benign Het
Other mutations in 2810474O19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:2810474O19Rik APN 6 149334750 utr 3 prime probably benign
IGL01401:2810474O19Rik APN 6 149326896 missense probably damaging 0.98
IGL01461:2810474O19Rik APN 6 149331515 unclassified probably benign
IGL01610:2810474O19Rik APN 6 149328951 missense probably benign 0.01
IGL02873:2810474O19Rik APN 6 149327040 missense probably damaging 1.00
IGL03202:2810474O19Rik APN 6 149326439 missense probably benign 0.08
grand_junction UTSW 6 149327878 missense probably damaging 0.98
grand_marais UTSW 6 149326460 nonsense probably null
3-1:2810474O19Rik UTSW 6 149327729 missense probably damaging 0.98
B6584:2810474O19Rik UTSW 6 149329346 missense probably damaging 0.96
PIT4280001:2810474O19Rik UTSW 6 149325525 missense probably benign 0.23
R0053:2810474O19Rik UTSW 6 149327590 missense probably benign 0.00
R0053:2810474O19Rik UTSW 6 149327590 missense probably benign 0.00
R0243:2810474O19Rik UTSW 6 149326241 missense probably damaging 1.00
R0620:2810474O19Rik UTSW 6 149328375 missense probably damaging 1.00
R0633:2810474O19Rik UTSW 6 149325701 missense probably benign 0.00
R0727:2810474O19Rik UTSW 6 149325822 missense possibly damaging 0.94
R0904:2810474O19Rik UTSW 6 149328269 missense probably damaging 0.99
R1221:2810474O19Rik UTSW 6 149326221 missense probably benign 0.24
R1435:2810474O19Rik UTSW 6 149326082 missense probably benign 0.04
R1452:2810474O19Rik UTSW 6 149326632 missense probably damaging 1.00
R1587:2810474O19Rik UTSW 6 149326520 missense probably damaging 1.00
R1912:2810474O19Rik UTSW 6 149328844 missense possibly damaging 0.80
R1926:2810474O19Rik UTSW 6 149329404 missense probably benign 0.39
R1978:2810474O19Rik UTSW 6 149326432 missense probably damaging 0.97
R2035:2810474O19Rik UTSW 6 149329226 missense possibly damaging 0.91
R2136:2810474O19Rik UTSW 6 149328822 missense probably benign 0.01
R2333:2810474O19Rik UTSW 6 149327511 missense probably damaging 1.00
R2360:2810474O19Rik UTSW 6 149334647 missense probably benign 0.05
R3027:2810474O19Rik UTSW 6 149329035 missense probably benign 0.02
R3121:2810474O19Rik UTSW 6 149329243 nonsense probably null
R3707:2810474O19Rik UTSW 6 149329113 missense probably damaging 0.98
R4204:2810474O19Rik UTSW 6 149329544 nonsense probably null
R4247:2810474O19Rik UTSW 6 149325543 missense possibly damaging 0.87
R4249:2810474O19Rik UTSW 6 149325543 missense possibly damaging 0.87
R4304:2810474O19Rik UTSW 6 149326238 nonsense probably null
R4385:2810474O19Rik UTSW 6 149326208 missense possibly damaging 0.93
R4702:2810474O19Rik UTSW 6 149329403 missense probably benign 0.05
R4747:2810474O19Rik UTSW 6 149326894 missense probably damaging 0.96
R4912:2810474O19Rik UTSW 6 149329389 missense probably damaging 1.00
R4913:2810474O19Rik UTSW 6 149329389 missense probably damaging 1.00
R4965:2810474O19Rik UTSW 6 149328398 nonsense probably null
R4971:2810474O19Rik UTSW 6 149325599 unclassified probably benign
R5077:2810474O19Rik UTSW 6 149326030 missense probably benign 0.14
R5213:2810474O19Rik UTSW 6 149326053 missense possibly damaging 0.77
R5382:2810474O19Rik UTSW 6 149326460 nonsense probably null
R5418:2810474O19Rik UTSW 6 149326136 missense probably damaging 1.00
R5452:2810474O19Rik UTSW 6 149329113 nonsense probably null
R5498:2810474O19Rik UTSW 6 149328240 missense probably damaging 0.99
R5673:2810474O19Rik UTSW 6 149327993 nonsense probably null
R5690:2810474O19Rik UTSW 6 149328237 missense possibly damaging 0.95
R5916:2810474O19Rik UTSW 6 149326578 missense probably damaging 0.99
R5917:2810474O19Rik UTSW 6 149334681 missense probably damaging 0.98
R6160:2810474O19Rik UTSW 6 149331507 critical splice donor site probably null
R6280:2810474O19Rik UTSW 6 149327057 missense probably damaging 1.00
R6326:2810474O19Rik UTSW 6 149328995 missense probably damaging 0.96
R6396:2810474O19Rik UTSW 6 149327919 missense probably damaging 1.00
R6702:2810474O19Rik UTSW 6 149327878 missense probably damaging 0.98
R6972:2810474O19Rik UTSW 6 149326109 missense probably damaging 0.99
R7127:2810474O19Rik UTSW 6 149327945 missense possibly damaging 0.95
R7168:2810474O19Rik UTSW 6 149327843 missense probably benign
R7316:2810474O19Rik UTSW 6 149326638 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACAGATCCGTGCAGGAGTAATACC -3'
(R):5'- GTGTTCTAGACGCCTCAGAGTGATG -3'

Sequencing Primer
(F):5'- CGTGCAGGAGTAATACCTCTTCAG -3'
(R):5'- CCTCAGAGTGATGGATCTTGAAGTC -3'
Posted On2014-01-29