Incidental Mutation 'R1282:Traf3ip2'
ID151066
Institutional Source Beutler Lab
Gene Symbol Traf3ip2
Ensembl Gene ENSMUSG00000019842
Gene NameTRAF3 interacting protein 2
SynonymsAct1
MMRRC Submission 039348-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R1282 (G1)
Quality Score158
Status Not validated
Chromosome10
Chromosomal Location39612934-39655307 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 39626405 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 183 (T183M)
Ref Sequence ENSEMBL: ENSMUSP00000019987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019987]
Predicted Effect probably damaging
Transcript: ENSMUST00000019987
AA Change: T183M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019987
Gene: ENSMUSG00000019842
AA Change: T183M

DomainStartEndE-ValueType
low complexity region 22 37 N/A INTRINSIC
low complexity region 94 106 N/A INTRINSIC
low complexity region 164 179 N/A INTRINSIC
Pfam:SEFIR 391 533 1.2e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151921
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153261
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in regulating responses to cytokines by members of the Rel/NF-kappaB transcription factor family. These factors play a central role in innate immunity in response to pathogens, inflammatory signals and stress. This gene product interacts with TRAF proteins (tumor necrosis factor receptor-associated factors) and either I-kappaB kinase or MAP kinase to activate either NF-kappaB or Jun kinase. Several alternative transcripts encoding different isoforms have been identified. Another transcript, which does not encode a protein and is transcribed in the opposite orientation, has been identified. Overexpression of this transcript has been shown to reduce expression of at least one of the protein encoding transcripts, suggesting it has a regulatory role in the expression of this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for one null allele exhibit splenomegaly, lymphadenopathy, increased number of B cells, defective IL-17 signaling, and increased immunoglobulin levels (including auto-antibodies) whereas mice homozygous for another null allele lack these features except the defect in IL-17 signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,329,172 Q1239* probably null Het
Acmsd T C 1: 127,738,560 Y23H probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Atp2a2 G T 5: 122,491,754 T84K probably benign Het
Cfap65 T A 1: 74,925,104 T562S probably benign Het
Cyp2b10 G A 7: 25,926,080 C436Y probably damaging Het
Dnajc7 T C 11: 100,584,641 D381G probably damaging Het
Dnase1l3 T C 14: 7,983,117 D129G probably benign Het
Espl1 A G 15: 102,315,391 T1126A probably benign Het
Exoc3 T C 13: 74,182,292 N506S probably benign Het
Fastkd3 C A 13: 68,584,557 N332K possibly damaging Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Foxp4 G A 17: 47,875,643 P404S unknown Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm12789 T A 4: 101,988,290 W59R probably damaging Het
Greb1l T A 18: 10,547,289 N1502K probably benign Het
H2-K1 A C 17: 33,999,447 I165S probably damaging Het
Ipo9 A G 1: 135,402,292 I470T possibly damaging Het
Kcnu1 A T 8: 25,905,957 I657F probably benign Het
Lrp1b A T 2: 40,860,761 N2930K probably damaging Het
Olfr683 T A 7: 105,143,652 I220F probably benign Het
Prag1 T C 8: 36,099,914 V73A probably damaging Het
Prrc2b T C 2: 32,223,444 I1963T probably damaging Het
Rep15 C T 6: 147,033,229 R189* probably null Het
Rtp3 T C 9: 110,986,920 K188E probably benign Het
Scd2 T C 19: 44,295,181 L101P probably damaging Het
Scn7a A T 2: 66,700,849 H561Q probably damaging Het
Sfr1 T C 19: 47,732,968 S118P probably damaging Het
Slf1 C T 13: 77,043,840 M958I probably damaging Het
Snrk G T 9: 122,160,520 R310L possibly damaging Het
Snx11 T C 11: 96,773,161 Y35C probably damaging Het
Supt6 T C 11: 78,228,768 T404A possibly damaging Het
Svep1 C A 4: 58,100,032 L1337F possibly damaging Het
Vmn2r28 A T 7: 5,481,302 M633K probably damaging Het
Vmn2r67 A G 7: 85,136,724 V691A probably benign Het
Other mutations in Traf3ip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01941:Traf3ip2 APN 10 39634660 missense probably benign
IGL02097:Traf3ip2 APN 10 39654479 missense probably damaging 0.99
IGL02530:Traf3ip2 APN 10 39646906 missense possibly damaging 0.80
IGL02957:Traf3ip2 APN 10 39654410 missense probably damaging 1.00
IGL03034:Traf3ip2 APN 10 39626219 missense probably damaging 1.00
IGL03123:Traf3ip2 APN 10 39639222 missense possibly damaging 0.87
IGL03386:Traf3ip2 APN 10 39645708 missense probably benign 0.03
R0328:Traf3ip2 UTSW 10 39634673 missense probably damaging 0.96
R1913:Traf3ip2 UTSW 10 39625940 missense probably benign 0.00
R2975:Traf3ip2 UTSW 10 39626540 missense probably benign 0.00
R4575:Traf3ip2 UTSW 10 39634654 missense probably damaging 0.97
R4576:Traf3ip2 UTSW 10 39634654 missense probably damaging 0.97
R4578:Traf3ip2 UTSW 10 39634654 missense probably damaging 0.97
R4670:Traf3ip2 UTSW 10 39639260 missense possibly damaging 0.76
R4680:Traf3ip2 UTSW 10 39639260 missense possibly damaging 0.76
R4681:Traf3ip2 UTSW 10 39639260 missense possibly damaging 0.76
R4710:Traf3ip2 UTSW 10 39639260 missense possibly damaging 0.76
R4742:Traf3ip2 UTSW 10 39639260 missense possibly damaging 0.76
R4760:Traf3ip2 UTSW 10 39645739 missense probably damaging 1.00
R4934:Traf3ip2 UTSW 10 39626100 missense probably damaging 1.00
R5079:Traf3ip2 UTSW 10 39626477 missense probably damaging 1.00
R5959:Traf3ip2 UTSW 10 39641341 missense probably benign 0.13
R6421:Traf3ip2 UTSW 10 39639404 splice site probably null
R6462:Traf3ip2 UTSW 10 39639247 missense probably benign 0.00
R7156:Traf3ip2 UTSW 10 39626177 missense possibly damaging 0.61
X0020:Traf3ip2 UTSW 10 39654519 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGATCTCAGCTTTCAGCAGCTTCTC -3'
(R):5'- TCAGTCCTAGTCCAGAACGTCCAG -3'

Sequencing Primer
(F):5'- AGCAGCTTCTCCTGACACTG -3'
(R):5'- ATAACTTACGTGGCACCTGG -3'
Posted On2014-01-29