Incidental Mutation 'R1264:Acadl'
ID151102
Institutional Source Beutler Lab
Gene Symbol Acadl
Ensembl Gene ENSMUSG00000026003
Gene Nameacyl-Coenzyme A dehydrogenase, long-chain
SynonymsLCAD, C79855
MMRRC Submission 039331-MU
Accession Numbers

Genbank: NM_007381.3; Ensembl: ENSMUST00000027153, ENSMUST00000139208

Is this an essential gene? Probably essential (E-score: 0.806) question?
Stock #R1264 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location66830839-66863277 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66857553 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 27 (C27S)
Ref Sequence ENSEMBL: ENSMUSP00000027153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027153]
Predicted Effect probably benign
Transcript: ENSMUST00000027153
AA Change: C27S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027153
Gene: ENSMUSG00000026003
AA Change: C27S

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:Acyl-CoA_dh_N 54 165 1.3e-33 PFAM
Pfam:Acyl-CoA_dh_M 169 266 9.2e-29 PFAM
Pfam:Acyl-CoA_dh_1 278 427 5.1e-44 PFAM
Pfam:Acyl-CoA_dh_2 293 416 3.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158795
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: This gene encodes a homotetrameric mitochondrial flavoprotein and is a member of the acyl-CoA dehydrogenase family. Members of this family catalyze the first step of fatty acid beta-oxidation, forming a C2-C3 trans-double bond in a FAD-dependent reaction. As beta-oxidation cycles through its four steps, each member of the acyl-CoA dehydrogenase family works at an optimum fatty acid chain-length. This enzyme has its optimum length between C12- and C16-acylCoA. In mice, deficiency of this gene can cause sudden death, cardiomyopathy as well as fasting and cold intolerance. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutation of this gene results in reduced litter size, sudden death between 2-14 weeks of age, reduced serum glucose levels, lipid accumulation in the liver and heart, and cardiomyopathy. Heterozygous mutant animals exhibit reduced litter size. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,646,377 probably benign Het
Adgrb3 C T 1: 25,559,850 G258E probably damaging Het
Akna T C 4: 63,381,725 probably null Het
Angpt2 T C 8: 18,741,217 N21S probably benign Het
Ano6 A G 15: 95,949,566 Y585C probably damaging Het
Ascc3 A T 10: 50,642,519 probably benign Het
Clec10a T A 11: 70,169,741 S103T possibly damaging Het
Clstn2 T C 9: 97,457,609 R770G probably benign Het
Cndp2 C A 18: 84,678,791 C95F possibly damaging Het
Col12a1 A G 9: 79,620,089 V2653A probably benign Het
Col4a3 A T 1: 82,643,301 probably benign Het
Daam1 A G 12: 71,975,311 probably benign Het
H2-M9 A G 17: 36,642,592 V18A probably benign Het
Heatr1 T A 13: 12,424,610 probably benign Het
Impg1 T C 9: 80,314,393 D715G probably benign Het
Incenp T C 19: 9,884,015 K425E unknown Het
Kif13b T C 14: 64,776,232 probably benign Het
Msh2 T A 17: 87,707,179 probably null Het
Myh2 A G 11: 67,180,778 N474D probably damaging Het
Myo18b T C 5: 112,830,319 T1246A probably benign Het
Nob1 T C 8: 107,421,504 H102R probably damaging Het
Olfr1427 G T 19: 12,098,834 D268E probably benign Het
Pard3b A T 1: 62,164,157 I415F probably damaging Het
Pfkl T G 10: 77,993,416 K386T possibly damaging Het
Plekhs1 T C 19: 56,485,763 V447A probably benign Het
Poli C T 18: 70,517,503 V266I probably benign Het
Rapgef4 A T 2: 72,031,105 K46N possibly damaging Het
Shisa6 T C 11: 66,375,149 probably benign Het
Six3 T A 17: 85,621,857 D206E probably damaging Het
Slc12a1 A T 2: 125,218,238 E944D possibly damaging Het
Sptb A G 12: 76,612,607 F1173S probably damaging Het
Tfdp1 C A 8: 13,373,837 probably benign Het
Trrap A G 5: 144,789,599 probably benign Het
Wbp11 A G 6: 136,814,515 probably benign Het
Other mutations in Acadl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Acadl APN 1 66841705 missense probably damaging 0.97
IGL01983:Acadl APN 1 66841624 nonsense probably null
IGL02550:Acadl APN 1 66845166 critical splice donor site probably null
IGL02934:Acadl APN 1 66836975 missense probably benign 0.33
IGL03002:Acadl APN 1 66836969 missense probably benign 0.01
B6584:Acadl UTSW 1 66848473 splice site probably benign
PIT4377001:Acadl UTSW 1 66838405 missense probably damaging 1.00
R0426:Acadl UTSW 1 66841646 missense probably damaging 0.99
R0639:Acadl UTSW 1 66857408 missense probably benign
R1589:Acadl UTSW 1 66853223 missense probably benign 0.04
R2066:Acadl UTSW 1 66841746 splice site probably null
R3735:Acadl UTSW 1 66853289 missense probably benign 0.41
R4646:Acadl UTSW 1 66831443 missense probably benign 0.00
R5690:Acadl UTSW 1 66853286 missense probably damaging 1.00
R6185:Acadl UTSW 1 66838363 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GAGTGGGCTAAGGCAGTACCTTTTC -3'
(R):5'- CTCCAACGGGCATTTTGATTGACAC -3'

Sequencing Primer
(F):5'- TGTTACATACGTTACAGCAGGG -3'
(R):5'- CACTGCAATGTTCAGTGACG -3'
Posted On2014-01-29