Incidental Mutation 'R1264:Rapgef4'
ID151104
Institutional Source Beutler Lab
Gene Symbol Rapgef4
Ensembl Gene ENSMUSG00000049044
Gene NameRap guanine nucleotide exchange factor (GEF) 4
SynonymscAMP-GEFII, Epac2, 1300003D15Rik, 5730402K07Rik, 6330581N18Rik
MMRRC Submission 039331-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.417) question?
Stock #R1264 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location71981240-72257474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72031105 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 46 (K46N)
Ref Sequence ENSEMBL: ENSMUSP00000099759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090826] [ENSMUST00000102698]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090826
AA Change: K46N

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000088336
Gene: ENSMUSG00000049044
AA Change: K46N

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
cNMP 43 162 4.62e-15 SMART
DEP 216 291 3.43e-27 SMART
low complexity region 302 311 N/A INTRINSIC
cNMP 356 475 4.02e-15 SMART
RasGEFN 495 630 3.61e-7 SMART
Blast:RasGEF 678 751 2e-33 BLAST
RasGEF 768 1010 8.09e-105 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102698
AA Change: K46N

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099759
Gene: ENSMUSG00000049044
AA Change: K46N

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
cNMP 43 162 4.62e-15 SMART
DEP 198 273 3.43e-27 SMART
low complexity region 284 293 N/A INTRINSIC
cNMP 338 457 4.02e-15 SMART
RasGEFN 477 612 3.61e-7 SMART
Blast:RasGEF 660 733 2e-33 BLAST
RasGEF 750 992 8.09e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150234
Meta Mutation Damage Score 0.022 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased insulin granule fusion in pancreatic islet cells during the first phase of cAMP-dependent insulin granule exocytosis. Mice homozygous for a knock-out allele exhibit impaired isoproterenol-induced SR calcium leak and arrhythmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,646,377 probably benign Het
Acadl A T 1: 66,857,553 C27S probably benign Het
Adgrb3 C T 1: 25,559,850 G258E probably damaging Het
Akna T C 4: 63,381,725 probably null Het
Angpt2 T C 8: 18,741,217 N21S probably benign Het
Ano6 A G 15: 95,949,566 Y585C probably damaging Het
Ascc3 A T 10: 50,642,519 probably benign Het
Clec10a T A 11: 70,169,741 S103T possibly damaging Het
Clstn2 T C 9: 97,457,609 R770G probably benign Het
Cndp2 C A 18: 84,678,791 C95F possibly damaging Het
Col12a1 A G 9: 79,620,089 V2653A probably benign Het
Col4a3 A T 1: 82,643,301 probably benign Het
Daam1 A G 12: 71,975,311 probably benign Het
H2-M9 A G 17: 36,642,592 V18A probably benign Het
Heatr1 T A 13: 12,424,610 probably benign Het
Impg1 T C 9: 80,314,393 D715G probably benign Het
Incenp T C 19: 9,884,015 K425E unknown Het
Kif13b T C 14: 64,776,232 probably benign Het
Msh2 T A 17: 87,707,179 probably null Het
Myh2 A G 11: 67,180,778 N474D probably damaging Het
Myo18b T C 5: 112,830,319 T1246A probably benign Het
Nob1 T C 8: 107,421,504 H102R probably damaging Het
Olfr1427 G T 19: 12,098,834 D268E probably benign Het
Pard3b A T 1: 62,164,157 I415F probably damaging Het
Pfkl T G 10: 77,993,416 K386T possibly damaging Het
Plekhs1 T C 19: 56,485,763 V447A probably benign Het
Poli C T 18: 70,517,503 V266I probably benign Het
Shisa6 T C 11: 66,375,149 probably benign Het
Six3 T A 17: 85,621,857 D206E probably damaging Het
Slc12a1 A T 2: 125,218,238 E944D possibly damaging Het
Sptb A G 12: 76,612,607 F1173S probably damaging Het
Tfdp1 C A 8: 13,373,837 probably benign Het
Trrap A G 5: 144,789,599 probably benign Het
Wbp11 A G 6: 136,814,515 probably benign Het
Other mutations in Rapgef4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Rapgef4 APN 2 72256312 missense possibly damaging 0.75
IGL00858:Rapgef4 APN 2 72198897 missense probably damaging 1.00
IGL01408:Rapgef4 APN 2 72174841 nonsense probably null
IGL01673:Rapgef4 APN 2 72241437 missense probably damaging 0.99
IGL01678:Rapgef4 APN 2 72242225 splice site probably benign
IGL01725:Rapgef4 APN 2 72174874 missense probably benign 0.24
IGL01871:Rapgef4 APN 2 72198360 missense possibly damaging 0.69
IGL01935:Rapgef4 APN 2 72234123 missense probably benign 0.05
IGL02001:Rapgef4 APN 2 72225052 splice site probably benign
IGL02041:Rapgef4 APN 2 72198796 missense probably damaging 1.00
IGL02134:Rapgef4 APN 2 72180061 missense probably damaging 0.97
IGL02410:Rapgef4 APN 2 72226594 missense possibly damaging 0.51
IGL02807:Rapgef4 APN 2 72205649 splice site probably benign
IGL03066:Rapgef4 APN 2 72141179 splice site probably benign
IGL03282:Rapgef4 APN 2 72205752 splice site probably benign
IGL03291:Rapgef4 APN 2 72195703 missense probably damaging 1.00
P0033:Rapgef4 UTSW 2 72137331 intron probably benign
R0045:Rapgef4 UTSW 2 72198778 missense possibly damaging 0.80
R0045:Rapgef4 UTSW 2 72198778 missense possibly damaging 0.80
R0309:Rapgef4 UTSW 2 72226030 missense probably benign 0.02
R0398:Rapgef4 UTSW 2 72031041 missense probably damaging 0.99
R0747:Rapgef4 UTSW 2 72223073 missense possibly damaging 0.66
R1216:Rapgef4 UTSW 2 72208148 missense possibly damaging 0.51
R1302:Rapgef4 UTSW 2 72045160 missense probably benign 0.31
R1460:Rapgef4 UTSW 2 72031176 critical splice donor site probably null
R1483:Rapgef4 UTSW 2 72055026 critical splice donor site probably null
R1682:Rapgef4 UTSW 2 72226568 missense possibly damaging 0.80
R1768:Rapgef4 UTSW 2 72225787 splice site probably benign
R1858:Rapgef4 UTSW 2 72031064 missense possibly damaging 0.67
R1860:Rapgef4 UTSW 2 72234720 missense probably benign 0.05
R1952:Rapgef4 UTSW 2 72208127 missense probably benign 0.07
R2025:Rapgef4 UTSW 2 72242739 missense probably benign 0.01
R2128:Rapgef4 UTSW 2 72226553 missense possibly damaging 0.87
R2159:Rapgef4 UTSW 2 72174881 missense probably damaging 1.00
R2201:Rapgef4 UTSW 2 72045189 missense probably damaging 0.96
R2883:Rapgef4 UTSW 2 72031125 missense probably benign
R3015:Rapgef4 UTSW 2 72198373 missense probably damaging 1.00
R4278:Rapgef4 UTSW 2 72198395 missense possibly damaging 0.95
R5256:Rapgef4 UTSW 2 72034034 missense probably damaging 0.97
R5572:Rapgef4 UTSW 2 72034120 critical splice donor site probably null
R5574:Rapgef4 UTSW 2 72034120 critical splice donor site probably null
R5575:Rapgef4 UTSW 2 72034120 critical splice donor site probably null
R5749:Rapgef4 UTSW 2 72242757 missense probably damaging 1.00
R6007:Rapgef4 UTSW 2 72179949 missense possibly damaging 0.55
R6084:Rapgef4 UTSW 2 72196278 critical splice donor site probably null
R6192:Rapgef4 UTSW 2 71981317 missense probably benign 0.00
R6409:Rapgef4 UTSW 2 72178237 missense probably benign 0.01
R6683:Rapgef4 UTSW 2 72054779 intron probably benign
R6774:Rapgef4 UTSW 2 72225775 missense probably benign 0.01
R6844:Rapgef4 UTSW 2 72234626 missense probably damaging 0.99
R6999:Rapgef4 UTSW 2 72239125 missense probably damaging 1.00
R7077:Rapgef4 UTSW 2 72241476 missense probably damaging 0.96
R7138:Rapgef4 UTSW 2 72198363 missense probably damaging 1.00
R7275:Rapgef4 UTSW 2 72208101 missense probably damaging 1.00
R7352:Rapgef4 UTSW 2 72180091 missense probably damaging 1.00
R7397:Rapgef4 UTSW 2 72205666 missense probably benign 0.23
R7508:Rapgef4 UTSW 2 72205733 missense probably benign 0.00
X0062:Rapgef4 UTSW 2 72226607 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CCACACCTTTGCTGTGGGGATTATC -3'
(R):5'- ACTTGGACACCCAAATATCTGGCAC -3'

Sequencing Primer
(F):5'- tgtggggtagacggagg -3'
(R):5'- AATATCTGGCACCAGACTCTGTG -3'
Posted On2014-01-29