Incidental Mutation 'R1264:Slc12a1'
ID151105
Institutional Source Beutler Lab
Gene Symbol Slc12a1
Ensembl Gene ENSMUSG00000027202
Gene Namesolute carrier family 12, member 1
Synonymsurehr3, mBSC1, Nkcc2, D630042G03Rik
MMRRC Submission 039331-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.353) question?
Stock #R1264 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location125152505-125230002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 125218238 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 944 (E944D)
Ref Sequence ENSEMBL: ENSMUSP00000028630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028630] [ENSMUST00000110494] [ENSMUST00000110495]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028630
AA Change: E944D

PolyPhen 2 Score 0.559 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028630
Gene: ENSMUSG00000027202
AA Change: E944D

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AA_permease_N 82 152 5.3e-22 PFAM
Pfam:AA_permease 173 677 2.3e-152 PFAM
Pfam:AA_permease_2 177 636 2.6e-24 PFAM
coiled coil region 815 843 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110494
AA Change: E944D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106120
Gene: ENSMUSG00000027202
AA Change: E944D

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AA_permease_N 83 148 3.3e-26 PFAM
Pfam:AA_permease 173 677 2.2e-151 PFAM
Pfam:SLC12 685 1090 1.5e-153 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110495
AA Change: E944D

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106121
Gene: ENSMUSG00000027202
AA Change: E944D

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AA_permease_N 83 148 3.3e-26 PFAM
Pfam:AA_permease 173 677 1.6e-151 PFAM
Pfam:SLC12 685 1090 1.5e-153 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123574
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kidney-specific sodium-potassium-chloride cotransporter that is expressed on the luminal membrane of renal epithelial cells of the thick ascending limb of Henle's loop and the macula densa. It plays a key role in concentrating urine and accounts for most of the NaCl resorption. It is sensitive to such diuretics as furosemide and bumetanide. Some Bartter-like syndromes result from defects in this gene. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their biological validity in humans has not been experimentally proven.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene do not survive to weaning and suffer from various metabolic abnormalities related to kidney function. Mice homozygous for an ENU-induced allele exhibit kidney disease, impaired urinary excretion of metabolism products, polyuria, and kidney alterations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,646,377 probably benign Het
Acadl A T 1: 66,857,553 C27S probably benign Het
Adgrb3 C T 1: 25,559,850 G258E probably damaging Het
Akna T C 4: 63,381,725 probably null Het
Angpt2 T C 8: 18,741,217 N21S probably benign Het
Ano6 A G 15: 95,949,566 Y585C probably damaging Het
Ascc3 A T 10: 50,642,519 probably benign Het
Clec10a T A 11: 70,169,741 S103T possibly damaging Het
Clstn2 T C 9: 97,457,609 R770G probably benign Het
Cndp2 C A 18: 84,678,791 C95F possibly damaging Het
Col12a1 A G 9: 79,620,089 V2653A probably benign Het
Col4a3 A T 1: 82,643,301 probably benign Het
Daam1 A G 12: 71,975,311 probably benign Het
H2-M9 A G 17: 36,642,592 V18A probably benign Het
Heatr1 T A 13: 12,424,610 probably benign Het
Impg1 T C 9: 80,314,393 D715G probably benign Het
Incenp T C 19: 9,884,015 K425E unknown Het
Kif13b T C 14: 64,776,232 probably benign Het
Msh2 T A 17: 87,707,179 probably null Het
Myh2 A G 11: 67,180,778 N474D probably damaging Het
Myo18b T C 5: 112,830,319 T1246A probably benign Het
Nob1 T C 8: 107,421,504 H102R probably damaging Het
Olfr1427 G T 19: 12,098,834 D268E probably benign Het
Pard3b A T 1: 62,164,157 I415F probably damaging Het
Pfkl T G 10: 77,993,416 K386T possibly damaging Het
Plekhs1 T C 19: 56,485,763 V447A probably benign Het
Poli C T 18: 70,517,503 V266I probably benign Het
Rapgef4 A T 2: 72,031,105 K46N possibly damaging Het
Shisa6 T C 11: 66,375,149 probably benign Het
Six3 T A 17: 85,621,857 D206E probably damaging Het
Sptb A G 12: 76,612,607 F1173S probably damaging Het
Tfdp1 C A 8: 13,373,837 probably benign Het
Trrap A G 5: 144,789,599 probably benign Het
Wbp11 A G 6: 136,814,515 probably benign Het
Other mutations in Slc12a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Slc12a1 APN 2 125188194 missense probably damaging 1.00
IGL00845:Slc12a1 APN 2 125188238 missense probably damaging 1.00
IGL01348:Slc12a1 APN 2 125194131 missense probably damaging 1.00
IGL01534:Slc12a1 APN 2 125217910 missense probably damaging 1.00
IGL01677:Slc12a1 APN 2 125178149 splice site probably benign
IGL02150:Slc12a1 APN 2 125184815 missense probably damaging 1.00
IGL02220:Slc12a1 APN 2 125188270 critical splice donor site probably null
IGL02568:Slc12a1 APN 2 125184728 missense probably damaging 1.00
IGL02602:Slc12a1 APN 2 125154242 missense probably damaging 1.00
IGL02625:Slc12a1 APN 2 125170691 missense probably damaging 1.00
IGL02635:Slc12a1 APN 2 125225978 missense probably benign
IGL02672:Slc12a1 APN 2 125170676 missense probably damaging 1.00
IGL02718:Slc12a1 APN 2 125161079 nonsense probably null
IGL03191:Slc12a1 APN 2 125206089 missense possibly damaging 0.87
FR4449:Slc12a1 UTSW 2 125154216 small insertion probably benign
FR4548:Slc12a1 UTSW 2 125154214 small insertion probably benign
FR4737:Slc12a1 UTSW 2 125154214 small insertion probably benign
R0033:Slc12a1 UTSW 2 125214009 missense probably benign
R0127:Slc12a1 UTSW 2 125219762 missense probably damaging 1.00
R0312:Slc12a1 UTSW 2 125226028 missense probably damaging 0.98
R0373:Slc12a1 UTSW 2 125226031 missense probably damaging 1.00
R0692:Slc12a1 UTSW 2 125194162 nonsense probably null
R1194:Slc12a1 UTSW 2 125184767 missense probably benign 0.00
R1529:Slc12a1 UTSW 2 125190295 missense probably damaging 1.00
R1543:Slc12a1 UTSW 2 125184857 missense possibly damaging 0.93
R1940:Slc12a1 UTSW 2 125194193 missense probably benign 0.05
R2109:Slc12a1 UTSW 2 125173699 missense probably damaging 1.00
R2167:Slc12a1 UTSW 2 125173681 missense probably damaging 1.00
R3409:Slc12a1 UTSW 2 125154151 missense probably benign 0.00
R3902:Slc12a1 UTSW 2 125188193 missense probably damaging 1.00
R4079:Slc12a1 UTSW 2 125200623 missense possibly damaging 0.86
R4502:Slc12a1 UTSW 2 125226044 missense probably damaging 1.00
R4557:Slc12a1 UTSW 2 125186641 missense probably damaging 1.00
R4719:Slc12a1 UTSW 2 125153993 missense possibly damaging 0.82
R4782:Slc12a1 UTSW 2 125161079 nonsense probably null
R4845:Slc12a1 UTSW 2 125188226 missense probably damaging 1.00
R4913:Slc12a1 UTSW 2 125228750 missense probably damaging 0.96
R5024:Slc12a1 UTSW 2 125166137 missense probably benign 0.00
R5112:Slc12a1 UTSW 2 125218224 missense possibly damaging 0.63
R5334:Slc12a1 UTSW 2 125217889 missense probably damaging 1.00
R5470:Slc12a1 UTSW 2 125170714 missense probably damaging 1.00
R6057:Slc12a1 UTSW 2 125190213 missense probably damaging 1.00
R6604:Slc12a1 UTSW 2 125184815 missense probably damaging 1.00
R6941:Slc12a1 UTSW 2 125214079 missense possibly damaging 0.85
R6944:Slc12a1 UTSW 2 125160534 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCCAGTTTCTGAGTTCCCAAAGACC -3'
(R):5'- CAGCTCCCAGTGACTGCACTAATG -3'

Sequencing Primer
(F):5'- GACCACAAGTCATTTAACAGCTATG -3'
(R):5'- cttccttccctccctccc -3'
Posted On2014-01-29