Incidental Mutation 'R1264:Wbp11'
ID151108
Institutional Source Beutler Lab
Gene Symbol Wbp11
Ensembl Gene ENSMUSG00000030216
Gene NameWW domain binding protein 11
SynonymsNpwbp, SIPP1, 2510026P17Rik, D6Wsu113e
MMRRC Submission 039331-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R1264 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location136813654-136828233 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 136814515 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074556] [ENSMUST00000116514] [ENSMUST00000203982] [ENSMUST00000204272]
Predicted Effect probably benign
Transcript: ENSMUST00000074556
SMART Domains Protein: ENSMUSP00000074142
Gene: ENSMUSG00000060032

DomainStartEndE-ValueType
H2A 3 123 2.32e-81 SMART
Predicted Effect unknown
Transcript: ENSMUST00000116514
AA Change: L540P
SMART Domains Protein: ENSMUSP00000112213
Gene: ENSMUSG00000030216
AA Change: L540P

DomainStartEndE-ValueType
Pfam:Wbp11 12 94 1e-26 PFAM
low complexity region 191 209 N/A INTRINSIC
low complexity region 263 284 N/A INTRINSIC
low complexity region 344 367 N/A INTRINSIC
low complexity region 380 532 N/A INTRINSIC
low complexity region 549 565 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203982
SMART Domains Protein: ENSMUSP00000144974
Gene: ENSMUSG00000060032

DomainStartEndE-ValueType
H2A 3 123 9.8e-84 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204129
Predicted Effect probably benign
Transcript: ENSMUST00000204272
SMART Domains Protein: ENSMUSP00000145501
Gene: ENSMUSG00000030216

DomainStartEndE-ValueType
Pfam:Wbp11 12 94 3.8e-24 PFAM
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein, which colocalizes with mRNA splicing factors and intermediate filament-containing perinuclear networks. This protein has 95% amino acid sequence identity to the mouse Wbp11 protein. It contains two proline-rich regions that bind to the WW domain of Npw38, a nuclear protein, and thus this protein is also called Npw38-binding protein NpwBP. The Npw38-NpwBP complex may function as a component of an mRNA factory in the nucleus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,646,377 probably benign Het
Acadl A T 1: 66,857,553 C27S probably benign Het
Adgrb3 C T 1: 25,559,850 G258E probably damaging Het
Akna T C 4: 63,381,725 probably null Het
Angpt2 T C 8: 18,741,217 N21S probably benign Het
Ano6 A G 15: 95,949,566 Y585C probably damaging Het
Ascc3 A T 10: 50,642,519 probably benign Het
Clec10a T A 11: 70,169,741 S103T possibly damaging Het
Clstn2 T C 9: 97,457,609 R770G probably benign Het
Cndp2 C A 18: 84,678,791 C95F possibly damaging Het
Col12a1 A G 9: 79,620,089 V2653A probably benign Het
Col4a3 A T 1: 82,643,301 probably benign Het
Daam1 A G 12: 71,975,311 probably benign Het
H2-M9 A G 17: 36,642,592 V18A probably benign Het
Heatr1 T A 13: 12,424,610 probably benign Het
Impg1 T C 9: 80,314,393 D715G probably benign Het
Incenp T C 19: 9,884,015 K425E unknown Het
Kif13b T C 14: 64,776,232 probably benign Het
Msh2 T A 17: 87,707,179 probably null Het
Myh2 A G 11: 67,180,778 N474D probably damaging Het
Myo18b T C 5: 112,830,319 T1246A probably benign Het
Nob1 T C 8: 107,421,504 H102R probably damaging Het
Olfr1427 G T 19: 12,098,834 D268E probably benign Het
Pard3b A T 1: 62,164,157 I415F probably damaging Het
Pfkl T G 10: 77,993,416 K386T possibly damaging Het
Plekhs1 T C 19: 56,485,763 V447A probably benign Het
Poli C T 18: 70,517,503 V266I probably benign Het
Rapgef4 A T 2: 72,031,105 K46N possibly damaging Het
Shisa6 T C 11: 66,375,149 probably benign Het
Six3 T A 17: 85,621,857 D206E probably damaging Het
Slc12a1 A T 2: 125,218,238 E944D possibly damaging Het
Sptb A G 12: 76,612,607 F1173S probably damaging Het
Tfdp1 C A 8: 13,373,837 probably benign Het
Trrap A G 5: 144,789,599 probably benign Het
Other mutations in Wbp11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Wbp11 APN 6 136821670 intron probably benign
IGL01408:Wbp11 APN 6 136814614 unclassified probably benign
R0639:Wbp11 UTSW 6 136816110 unclassified probably benign
R0685:Wbp11 UTSW 6 136814638 unclassified probably benign
R1987:Wbp11 UTSW 6 136820585 missense probably damaging 0.99
R2362:Wbp11 UTSW 6 136824332 missense probably damaging 1.00
R4646:Wbp11 UTSW 6 136821191 missense probably benign 0.10
R5682:Wbp11 UTSW 6 136814254 unclassified probably benign
R6045:Wbp11 UTSW 6 136821535 missense probably damaging 0.99
R6386:Wbp11 UTSW 6 136820525 missense probably benign 0.36
R6567:Wbp11 UTSW 6 136820539 missense probably benign 0.02
R7132:Wbp11 UTSW 6 136821542 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- CCAGTACTCTGAACAGAAGCCTGTCC -3'
(R):5'- GTGGCAGTTAAATGTCGCCAATTCTTG -3'

Sequencing Primer
(F):5'- GTTTGTACTGAGACAGCAACTG -3'
(R):5'- AAATGTCGCCAATTCTTGTACTC -3'
Posted On2014-01-29