Incidental Mutation 'R1264:Angpt2'
ID151111
Institutional Source Beutler Lab
Gene Symbol Angpt2
Ensembl Gene ENSMUSG00000031465
Gene Nameangiopoietin 2
SynonymsAng2, Ang-2
MMRRC Submission 039331-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.924) question?
Stock #R1264 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location18690263-18741562 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18741217 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 21 (N21S)
Ref Sequence ENSEMBL: ENSMUSP00000033846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033846] [ENSMUST00000039412]
Predicted Effect probably benign
Transcript: ENSMUST00000033846
AA Change: N21S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000033846
Gene: ENSMUSG00000031465
AA Change: N21S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
coiled coil region 166 248 N/A INTRINSIC
FBG 279 494 9.43e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000039412
SMART Domains Protein: ENSMUSP00000037000
Gene: ENSMUSG00000039842

DomainStartEndE-ValueType
BRCT 13 89 2.64e-4 SMART
coiled coil region 128 155 N/A INTRINSIC
Pfam:Microcephalin 224 597 1.2e-143 PFAM
BRCT 624 707 2.23e-2 SMART
BRCT 740 810 1.55e-1 SMART
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: This gene encodes an endothelial cell (EC)-derived regulator of angiogenesis and ligand for endothelial-specific receptor tyrosine kinase. The encoded protein acts as an anti-apoptotic factor for stressed ECs and a proapoptotic factor for resting ECs. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous inactivation of this gene results in impaired angiogenesis, abnormal lymphatic development and function, and ultimately postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,646,377 probably benign Het
Acadl A T 1: 66,857,553 C27S probably benign Het
Adgrb3 C T 1: 25,559,850 G258E probably damaging Het
Akna T C 4: 63,381,725 probably null Het
Ano6 A G 15: 95,949,566 Y585C probably damaging Het
Ascc3 A T 10: 50,642,519 probably benign Het
Clec10a T A 11: 70,169,741 S103T possibly damaging Het
Clstn2 T C 9: 97,457,609 R770G probably benign Het
Cndp2 C A 18: 84,678,791 C95F possibly damaging Het
Col12a1 A G 9: 79,620,089 V2653A probably benign Het
Col4a3 A T 1: 82,643,301 probably benign Het
Daam1 A G 12: 71,975,311 probably benign Het
H2-M9 A G 17: 36,642,592 V18A probably benign Het
Heatr1 T A 13: 12,424,610 probably benign Het
Impg1 T C 9: 80,314,393 D715G probably benign Het
Incenp T C 19: 9,884,015 K425E unknown Het
Kif13b T C 14: 64,776,232 probably benign Het
Msh2 T A 17: 87,707,179 probably null Het
Myh2 A G 11: 67,180,778 N474D probably damaging Het
Myo18b T C 5: 112,830,319 T1246A probably benign Het
Nob1 T C 8: 107,421,504 H102R probably damaging Het
Olfr1427 G T 19: 12,098,834 D268E probably benign Het
Pard3b A T 1: 62,164,157 I415F probably damaging Het
Pfkl T G 10: 77,993,416 K386T possibly damaging Het
Plekhs1 T C 19: 56,485,763 V447A probably benign Het
Poli C T 18: 70,517,503 V266I probably benign Het
Rapgef4 A T 2: 72,031,105 K46N possibly damaging Het
Shisa6 T C 11: 66,375,149 probably benign Het
Six3 T A 17: 85,621,857 D206E probably damaging Het
Slc12a1 A T 2: 125,218,238 E944D possibly damaging Het
Sptb A G 12: 76,612,607 F1173S probably damaging Het
Tfdp1 C A 8: 13,373,837 probably benign Het
Trrap A G 5: 144,789,599 probably benign Het
Wbp11 A G 6: 136,814,515 probably benign Het
Other mutations in Angpt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01298:Angpt2 APN 8 18710528 missense probably benign 0.01
IGL01449:Angpt2 APN 8 18710625 missense probably benign 0.01
IGL03088:Angpt2 APN 8 18741023 missense probably benign 0.09
P0037:Angpt2 UTSW 8 18714243 unclassified probably benign
R0308:Angpt2 UTSW 8 18692125 missense possibly damaging 0.93
R1099:Angpt2 UTSW 8 18699133 missense probably damaging 1.00
R1113:Angpt2 UTSW 8 18692118 nonsense probably null
R1308:Angpt2 UTSW 8 18692118 nonsense probably null
R1518:Angpt2 UTSW 8 18705839 missense probably benign 0.00
R1595:Angpt2 UTSW 8 18698113 missense probably damaging 1.00
R2016:Angpt2 UTSW 8 18705731 missense probably damaging 0.96
R2017:Angpt2 UTSW 8 18705731 missense probably damaging 0.96
R2050:Angpt2 UTSW 8 18705657 missense probably benign
R2142:Angpt2 UTSW 8 18714140 missense probably benign 0.39
R2184:Angpt2 UTSW 8 18692116 missense probably benign 0.00
R3028:Angpt2 UTSW 8 18703544 missense probably benign 0.01
R4096:Angpt2 UTSW 8 18698095 missense probably damaging 0.97
R4112:Angpt2 UTSW 8 18699123 missense probably damaging 1.00
R4738:Angpt2 UTSW 8 18741059 missense probably benign 0.07
R4790:Angpt2 UTSW 8 18714082 missense probably damaging 1.00
R4935:Angpt2 UTSW 8 18692115 missense probably damaging 1.00
R6056:Angpt2 UTSW 8 18698116 missense probably benign 0.00
R6499:Angpt2 UTSW 8 18694517 missense probably benign
R6938:Angpt2 UTSW 8 18698089 nonsense probably null
R7211:Angpt2 UTSW 8 18741131 missense probably benign
R7323:Angpt2 UTSW 8 18705824 missense probably benign 0.13
R7349:Angpt2 UTSW 8 18692074 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGTTCTTGCTCACCAGAGCCAGC -3'
(R):5'- ACTGATGGACTTATTCACACGGCAC -3'

Sequencing Primer
(F):5'- ATCAGCCACTGTGTGTTGTTC -3'
(R):5'- ACAGCCCTGTGCCTTAGAC -3'
Posted On2014-01-29