Incidental Mutation 'R1264:Impg1'
ID151114
Institutional Source Beutler Lab
Gene Symbol Impg1
Ensembl Gene ENSMUSG00000032343
Gene Nameinterphotoreceptor matrix proteoglycan 1
SynonymsIMP150, SPACR, A930015H12Rik
MMRRC Submission 039331-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R1264 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location80313330-80465481 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80314393 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 715 (D715G)
Ref Sequence ENSEMBL: ENSMUSP00000082395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035889] [ENSMUST00000076140] [ENSMUST00000085289] [ENSMUST00000113250] [ENSMUST00000113266] [ENSMUST00000113268]
Predicted Effect probably benign
Transcript: ENSMUST00000035889
SMART Domains Protein: ENSMUSP00000036181
Gene: ENSMUSG00000033577

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1113 3e-29 BLAST
PDB:3H8D|D 1134 1262 1e-74 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000076140
SMART Domains Protein: ENSMUSP00000075501
Gene: ENSMUSG00000033577

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1126 2e-27 BLAST
PDB:3H8D|D 1138 1266 8e-75 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000085289
AA Change: D715G

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000082395
Gene: ENSMUSG00000032343
AA Change: D715G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SEA 158 273 8.68e-1 SMART
low complexity region 353 374 N/A INTRINSIC
SEA 494 616 1.37e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113250
AA Change: D792G

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108876
Gene: ENSMUSG00000032343
AA Change: D792G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SEA 235 350 8.68e-1 SMART
low complexity region 430 451 N/A INTRINSIC
SEA 571 693 1.37e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113266
SMART Domains Protein: ENSMUSP00000108891
Gene: ENSMUSG00000033577

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1113 3e-29 BLAST
PDB:3H8D|D 1125 1253 9e-75 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000113268
SMART Domains Protein: ENSMUSP00000108893
Gene: ENSMUSG00000033577

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1135 2e-26 BLAST
Pfam:Myosin-VI_CBD 1167 1257 1.4e-46 PFAM
Meta Mutation Damage Score 0.1596 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a major component of the retinal interphotoreceptor matrix. The encoded protein is a proteoglycan that is thought to play a role in maintaining viability of photoreceptor cells and in adhesion of the neural retina to the retinal pigment epithelium. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,646,377 probably benign Het
Acadl A T 1: 66,857,553 C27S probably benign Het
Adgrb3 C T 1: 25,559,850 G258E probably damaging Het
Akna T C 4: 63,381,725 probably null Het
Angpt2 T C 8: 18,741,217 N21S probably benign Het
Ano6 A G 15: 95,949,566 Y585C probably damaging Het
Ascc3 A T 10: 50,642,519 probably benign Het
Clec10a T A 11: 70,169,741 S103T possibly damaging Het
Clstn2 T C 9: 97,457,609 R770G probably benign Het
Cndp2 C A 18: 84,678,791 C95F possibly damaging Het
Col12a1 A G 9: 79,620,089 V2653A probably benign Het
Col4a3 A T 1: 82,643,301 probably benign Het
Daam1 A G 12: 71,975,311 probably benign Het
H2-M9 A G 17: 36,642,592 V18A probably benign Het
Heatr1 T A 13: 12,424,610 probably benign Het
Incenp T C 19: 9,884,015 K425E unknown Het
Kif13b T C 14: 64,776,232 probably benign Het
Msh2 T A 17: 87,707,179 probably null Het
Myh2 A G 11: 67,180,778 N474D probably damaging Het
Myo18b T C 5: 112,830,319 T1246A probably benign Het
Nob1 T C 8: 107,421,504 H102R probably damaging Het
Olfr1427 G T 19: 12,098,834 D268E probably benign Het
Pard3b A T 1: 62,164,157 I415F probably damaging Het
Pfkl T G 10: 77,993,416 K386T possibly damaging Het
Plekhs1 T C 19: 56,485,763 V447A probably benign Het
Poli C T 18: 70,517,503 V266I probably benign Het
Rapgef4 A T 2: 72,031,105 K46N possibly damaging Het
Shisa6 T C 11: 66,375,149 probably benign Het
Six3 T A 17: 85,621,857 D206E probably damaging Het
Slc12a1 A T 2: 125,218,238 E944D possibly damaging Het
Sptb A G 12: 76,612,607 F1173S probably damaging Het
Tfdp1 C A 8: 13,373,837 probably benign Het
Trrap A G 5: 144,789,599 probably benign Het
Wbp11 A G 6: 136,814,515 probably benign Het
Other mutations in Impg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Impg1 APN 9 80322829 missense probably benign 0.02
IGL01733:Impg1 APN 9 80341924 missense probably damaging 0.99
IGL02333:Impg1 APN 9 80440755 missense possibly damaging 0.74
IGL03097:Impg1 UTSW 9 80379952 missense possibly damaging 0.48
R0021:Impg1 UTSW 9 80435426 missense probably damaging 1.00
R0029:Impg1 UTSW 9 80398371 missense probably damaging 1.00
R0029:Impg1 UTSW 9 80398371 missense probably damaging 1.00
R0108:Impg1 UTSW 9 80322848 missense possibly damaging 0.63
R0201:Impg1 UTSW 9 80345561 missense probably damaging 1.00
R0271:Impg1 UTSW 9 80386879 splice site probably benign
R0316:Impg1 UTSW 9 80342065 missense probably damaging 1.00
R0492:Impg1 UTSW 9 80345308 missense possibly damaging 0.74
R0633:Impg1 UTSW 9 80394155 missense possibly damaging 0.72
R0705:Impg1 UTSW 9 80379979 missense probably damaging 1.00
R0962:Impg1 UTSW 9 80381741 missense probably benign 0.23
R1707:Impg1 UTSW 9 80378517 splice site probably null
R2017:Impg1 UTSW 9 80440667 missense probably damaging 1.00
R3904:Impg1 UTSW 9 80345585 missense possibly damaging 0.76
R3960:Impg1 UTSW 9 80440864 missense probably benign 0.00
R4231:Impg1 UTSW 9 80345329 missense probably damaging 1.00
R4233:Impg1 UTSW 9 80345329 missense probably damaging 1.00
R4235:Impg1 UTSW 9 80345329 missense probably damaging 1.00
R4236:Impg1 UTSW 9 80345329 missense probably damaging 1.00
R4490:Impg1 UTSW 9 80394059 missense probably damaging 1.00
R4592:Impg1 UTSW 9 80440854 missense probably benign 0.05
R4701:Impg1 UTSW 9 80314400 missense probably benign 0.07
R4785:Impg1 UTSW 9 80398450 missense probably benign 0.01
R4796:Impg1 UTSW 9 80394095 missense probably damaging 0.99
R4923:Impg1 UTSW 9 80345545 missense probably damaging 0.98
R4923:Impg1 UTSW 9 80345078 nonsense probably null
R5468:Impg1 UTSW 9 80465265 missense probably benign 0.05
R5596:Impg1 UTSW 9 80345218 missense probably benign 0.24
R6001:Impg1 UTSW 9 80316172 missense probably benign 0.12
R6156:Impg1 UTSW 9 80322824 missense probably damaging 1.00
R6315:Impg1 UTSW 9 80394074 missense probably benign 0.21
R6419:Impg1 UTSW 9 80380018 missense probably benign 0.38
R6880:Impg1 UTSW 9 80404800 missense probably damaging 1.00
R7013:Impg1 UTSW 9 80378494 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAATACACGCCTGTGCTCTTGTTC -3'
(R):5'- GATGCGGTCCCAGTGGGTTATAAAG -3'

Sequencing Primer
(F):5'- GTTCAAGCATGCTGAGTCTC -3'
(R):5'- GTCCCAGTGGGTTATAAAGTTAAG -3'
Posted On2014-01-29